*Corresponding Author: Circular RNAs (circRNAs), covalently closed RNA molecules that form due to back-splicing of RNA transcripts, have recently been implicated in Alzheimer9s disease and related tauopathies. circRNAs are regulated by N6-methyladenosine (m A) RNA methylation, can serve as <sponges= 6 for proteins and RNAs, and can be translated into protein via a cap-independent mechanism. Mechanisms underlying circRNA dysregulation in tauopathies and causal relationships between circRNA and neurodegeneration are currently unknown. In the current study, we aimed to determine whether pathogenic forms of tau drive circRNA dysregulation and whether such dysregulation causally mediates neurodegeneration. We identify circRNAs that are differentially expressed in the brain of a Drosophila model of tauopathy and in induced pluripotent stem cell (iPSC)-derived neurons carrying a tau mutation associated with autosomal dominant tauopathy. We leverage Drosophila to discover that depletion of circular forms of muscleblind (circMbl), a circRNA that is particularly abundant in brains of tau transgenic Drosophila, significantly suppresses tau neurotoxicity, suggesting that tau-induced circMbl elevation is neurotoxic. We 6 detect a general elevation of m A RNA methylation and circRNA methylation in tau transgenic 6 Drosophila and find that tau-induced m A methylation is a mechanistic driver of circMbl formation. Interestingly, we find that circRNA and

6 m A

RNA accumulate within nuclear envelope invaginations of tau transgenic Drosophila and in iPSC-derived cerebral organoid models of tauopathy. Taken together, our studies add critical new insight into the mechanisms underlying 6 circRNA dysregulation in tauopathy and identify m A-modified circRNA as a causal factor contributing to neurodegeneration. These findings add to a growing literature implicating pathogenic forms of tau as drivers of altered RNA metabolism.

Alzheimer9s disease is a progressive neurodegeneraitve disorder and the most common cause of dementia (Knopman et al., 2021). The neuropathological hallmarks of Alzheimer9s disease, amyloid beta plaques and tau tangles, form decades prior to cognitive decline (Braak et al., 2011). In addition to Alzheimer9s disease, tau aggregates are a defining feature of diverse neurodegenerative disorders collectively known as <tauopathies,= some of which arise due to mutations in the MAPT gene (Hutton et al., 1998; Poorkaj et al., 1998; Spillantini et al., 1998), which encodes tau protein. Various models of tauopathy that rely on transgenic expression of frontotemporal dementia-associated MAPT mutants have provided novel insights into the basic biology underlying human Alzheimer9s disease and related tauopathies (Khurana, 2008; Jankowsky & Zheng, 2017), despite the fact that most primary and secondary tauopathies are sporadic and thus involve the deposition of wild-type forms of tau. Studies in Drosophila models of tauopathy indicate that pathogenic forms of wild-type tau and tau harboring various frontotemporal dementia-associated mutations drive neurotoxicity through a common pathway involving the actin cytoskeleton and consequent changes in nuclear and genomic architecture (Frost et al., 2014; Frost et al., 2016; Bardai et al., 2018).

We and others have previously reported that wild-type and mutant forms of tau drive neurodegeneration by negatively affecting the overall three-dimensional structure of the nucleus. Neurons from brains of tau transgenic Drosophila, human brain affected by Alzheimer9s disease (Frost et al., 2016) frontotemporal dementia due to MAPT mutation, iPSC-derived neurons carrying a MAPT mutation (Paonessa et al., 2019), cultured HEK293 or neuroblastoma cells with induced tau expression (Montalbano et al., 2020; Sohn et al., 2023), and primary cultured cortical neurons with optogenetically-induced tau multimerization (L. Jiang et al., 2021) harbor nuclear invaginations and/or blebs. Studies in tau transgenic Drosophila suggest that such nuclear pleomorphisms are caused by destabilization of the lamin nucleoskeleton and causally mediate neuronal death (Frost et al., 2016).

We have previously discovered that polyadenylated (polyA) RNA accumulates within tauinduced nuclear invaginations and blebs in the Drosophila brain, and that such accumulation can be reduced by genetic or pharmacologic reduction of RNA export, which also suppresses tauinduced neurotoxicity (Cornelison et al., 2019). Along with studies showing that pathogenic forms of tau trigger and/or are associated with abnormal RNA splicing and intron retention (Apicco et al., 2019; Hsieh et al., 2019; Koren et al., 2020), we recently found that clearance of aberrant RNA transcripts via nonsense-mediated mRNA decay (NMD) is blunted in tauopathy, and that proteins translated from RNA carrying NMD-triggering features also accumulate in tau-induced nuclear blebs (Zuniga et al., 2022). There is thus a growing literature documenting alterations in RNA metabolism in tauopathy, and association of such RNA species with tau-induced nuclear pleomorphisms.

We became interested in the potential role of tau as a mediator of circRNA biogenesis based on previous findings that circRNAs are differentially expressed in human Alzheimer9s disease brain tissue (Dube et al., 2019). CircRNA biogenesis occurs through a back-splicing event that is independent of the parental linear RNA (Salzman et al., 2013; Knupp & Miura, 2018). With stable structure and long half-life in cerebrospinal fluid, circRNAs are hallmarks of aging that have been proposed as potential biomarkers for neurodegenerative disorders (Memczak et al., 2015; Knupp & Miura, 2018; Dube et al., 2019). Mechanistically, circRNA can serve as a sponge for complementary RNAs and RNA binding proteins (Hansen et al., 2013; Memczak et al., 2013; Gokool et al., 2020). In addition, recent work suggests that some circRNAs can be actively translated into protein via a cap-independent translation mechanism (Pamudurti et al., 2017; Yang et al., 2017). CircRNA formation, subsequent export from the nucleus, and, in some cases, 6 translation into protein, are regulated in part by m A modification (Yang et al., 2017; Di Timoteo 6 et al., 2020), the most abundant RNA modification in eukaryotes. While m A modified RNA is elevated in human Alzheimer9s disease and in tau tarnsgenic mice (Han et al., 2020; L. Jiang et al., 2021), circRNA is dysregulated in Alzheimer9sdisease, and m6A is known to regulate circRNA formation, the link between tau, m6A, circRNA and neurotoxicity have yet to be explored.

In the current study, we find that circMbl is significantly elevated as a consequence of transgenic panneuronal expression of a frontotemporal dementia-associated human MAPT mutation (tauR406W) in the adult Drosophila brain. Genetic reduction of circMbl suppresses tauinduced neuronal death, suggesting that circMbl mediates tau neurotoxicity. Mechanistically, we find that tau-induced elevation of RNA methylation regulates circMbl abundance in brains of tau 6 transgenic Drosophila and observe that circRNA and m A closely associate with nuclear blebs that form in tau transgenic Drosophila and in iPSC-derived cerebral organoids from a patient harboring a MAPT mutation (tauIVS10+16). Taken together, our studies reveal a previously unknown link between tau, RNA methylation, circRNA biogenesis, and neurodegeneration, and point toward the potential involvement of nuclear blebs as a nuclear export system for accumulating circRNA.

Formation of aberrantly phosphorylated, misfolded tau species lead to neuronal death and cognitive decline in various laboratory models of tauopathy, including Drosophila. We used a welldescribed Drosophila model of tauopathy (Wittmann et al., 2001) to determine if the differential expression of circRNAs observed in human Alzheimer9s disease cases was conserved in this model. Pan-neuronal expression of human tau carrying the frontotemporal dementia-associated R406W (Hutton et al., 1998) mutation in the adult Drosophila brain causes age-associated neuronal death, shortened lifespan, and decreased locomotor activity (Wittmann et al., 2001;

Frost et al., 2014). This model recapitulates many cellular features of human Alzheimer9s disease and related tauopathies, including but not limited to aberrant tau phosphorylation, oxidative stress (Dias-Santagata et al., 2007), DNA damage (Khurana et al., 2012), and nuclear envelope invaginations and blebs (Frost et al., 2016).

We utilized the circRNA analysis tool DCC (Cheng et al., 2016) to identify differentially expressed circRNAs (Supplemental Dataset 1) in a publicly available RNA-seq dataset from heads of control and tauR406W transgenic Drosophila at day 10 of adulthood (Mahoney et al., 2020), an age at which neuronal death and locomotor deficits are detectable in this model but prior to significant decline in survival (Frost et al., 2014). CircRNA analysis algorithms recognize the backsplice junction that forms between the 59 and 39 edns of exons when RNAs circularize (Fig. 1A). We identify circular forms of muscleblind (mbl) and beaten path Vc (beat-Vc) as significantly elevated in heads of tauR406W transgenic Drosophila (Fig. 1B). As muscleblind is known for its role in splicing, transcript localization, and miRNA/circRNA biogenesis (Houseley et al., 2006), and has previously been implicated in various neurological disorders (Kanadia et al., 2003; de Haro et al., 2006; Rudnicki et al., 2007; Li et al., 2008; Daughters et al., 2009; Sellier et al., 2010; Casci et al., 2019), we focused on circMbl (Fig. 1C) for subsequent mechanistic analyses.

RNA-seq reveals that levels of linear mbl transcript are unchanged in tauR406W transgenic Drosophila versus controls (Fig. 1D), consistent with previous reports that circRNA levels are independent of their linear RNA counterparts (Ashwal-Fluss et al., 2014). We next designed digital PCR (dPCR) probes to specifically detect the 59-39back-splice junction of circMbl (Fig. 1E). dPCR of RNA extracted from control and tauR406W transgenic heads confirms that this circRNA species is significantly elevated in tauR406W transgenic Drosophila (Fig. 1F). Taken together, our data suggests that pathogenic forms of tau drive an increase in circular, but not linear, mbl transcripts. R406W transgenic Drosophila.

A. Cartoon depicting formation of circRNA from a linear transcript. Back-splice junction indicates a circRNA. B. Differentially expressed circRNAs in tauR406W transgenic Drosophila heads compared to control based on DCC RNA-seq analysis. Dashed line indicates an adjusted p value of 0.05. C. CircMbl in tauR406W transgenic Drosophila heads is significantly increased compared to control based on DCC analysis. D. RNA-seq based reads for linear mbl. E. Cartoon depicting the 59-39 back-splice junction ofcircMbl used to design dPCR probes. F. CircMbl copies are significantly elevated in tauR406W transgenic Drosophila compared to control based on dPCR. n = 6 biological replicates per genotype. **p < 0.01, unpaired t-test. Error bars = SEM. All analyses were performed at day 10 of adulthood.

Having found that circMbl is significantly elevated in brains of tau transgenic Drosophila, we next asked if tau-induced elevation of circMbl causally drives neurotoxicity. We reduced circMbl and total mbl in neurons of tau transgenic Drosophila using two approaches: 1) Targeted depletion of circMbl via pan-neuronal expression of a small hairpin RNA that is complementary to the exon 2

KD back-splice junction in circMbl (circMbl ) (Pamudurti et al., 2022) and 2) General pan-neuronal

RNAi RNAi-mediated knockdown of mbl (mbl

), which targets linear mbl and circMbl. We find that KD

RNAi both circMbl and mbl

significantly deplete circMbl in brains of tau transgenic Drosophila based on dPCR (Fig. 2A). To further confirm that circMbl is reduced in the context of circMbl and mbl

, we designed fluorescence in situ hybridization (FISH) probes to detect the 59-39 bcaksplice junction of circMbl. Indeed, we observe significantly less circMbl in brains of tau transgenic flies with circMbl

KD or mbl

RNAi , consistent with dPCR (Fig. 2B, C).

KD

RNAi Having established that circMbl and mbl significantly deplete overall levels of circMbl in brains of tau transgenic Drosophila, we next determined if tau-induced elevation of circMbl causally mediates neurodegeneration using three different commonly-used assays of tau-induced neurotoxicity in Drosophila. We find that circMbl and mbl

suppress the tau-induced rough KD

RNAi eye phenotype (Fig. 2D), and significantly improve tau-induced deficits in locomotor activity (Fig. 2F). To quantify neurodegeneration in the brain directly, we utilized the Terminal deoxynucleotidyl Transferase (TdT) dUTP Nick-End Labeling (TUNEL) assay, which labels DNA damage associated with apoptotic cell death (Kyrylkova et al., 2012). We find that depletion of circMbl or mbl significantly reduces apoptotic cell death in brains of tau transgenic Drosophila (Fig. 2G), and slightly but significantly reduces levels of tau protein (Supplemental Fig. 1A, B). brain. A. Panneuronal expression of circMbl

KD

RNAi significantly reduce circMbl in heads of tau transgenic Drosophila based on dPCR. B. FISH-based detection of circMbl in tau, tau+circMblKD and tau+Mbl

RNAi KD Drosophila brains. C. Quantification of (B). D. circMbl and mbl RNAi suppress the tau-induced rough eye phenotype. E. circMbl

suppress tau-induced neurodegeneration based on TUNEL. n = 6 or 18 biological replicates per genotype. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ANOVA with a post-hoc Tukey test was used for multiple comparisons. Error bars = SEM. All analyses were performed at day 10 of adulthood.

Having identified circRNAs that are elevated in brains of tau transgenic Drosophila, and that tauinduced elevation of circMbl causally mediates neurotoxicity, we next investigated the mechanism underlying tau-induced circMbl elevation in tau transgenic Drosophila. It is now well understood that RNA is subject to epigenetic modification, and that such modifications regulate RNA alternative splicing, circularization, stability, nuclear export, and translation (X. Jiang et al., 2021).

6 As m A is the most common epigenetic modification of RNA (Dubin & Taylor, 1975; Perry et al., 1975) and is reported to regulate RNA circularization (Zhou et al., 2017), we investigated RNA methylation as a candidate mechanism regulating tau-induced elevation of circRNA. We first 6 analyzed overall levels of m A in total head lysates from tau transgenic Drosophila. Based on dot 6 blot, we find a significant increase in total m A levels in the Drosophila model of tauopathy 6 6 compared to control (Fig. 3A, B). To visualize m A in the brain directly, we performed m A immunofluorescence in brains of control and tau transgenic Drosophila. These analyses further 6 indicate that m A is significantly elevated in the context of tauopathy (Fig. 3C, D).

We next determined the degree to which circRNAs are methylated in head lysates from control and tau transgenic Drosophila. We first enriched for circRNA by digesting linear RNA with 6 Ribonuclease R, then subjected remaining circRNA to m A analysis via dot blot. We find that 6 circRNAs are m A modified to a greater extent in tau transgenic Drosophila compared to control 6 (Fig. 3E, F). To investigate the m A status of circMbl specifically, we performed EpiQuik 6 CUT&RUN m A RNA Enrichment (MeRIP) followed by dPCR using circMbl-specific probes. We 6 find that m A modification of circMbl is significantly elevated in tau transgenic flies compared to control (Fig. 3G).

6 Figure 3. m A mediates tau-induced circularization of mbl in brains of tau transgenic 6 Drosophila. A. Levels of m A in total RNA from control and tau transgenic Drosophila based on dot blot. RNA was loaded to the blot at increasing concentrations for each genotype. B.

6 Quantification of (A). C. Visualization of m A in brains of control and tau transgenic Drosophila 6 based on immunofluorescence. D. Quantification of (C). E. Levels of m A in RNase R-treated RNA samples from control and tau transgenic Drosophila based on dot blot. RNA was loaded to the blot at increasing concentrations for each genotype. F. Quantification of (E). G. CircMbl copies in m A enriched RNA (me-RIP) samples from control and tauR406W. n = 6 biological replicates per 6 genotype. *p<0.05, **p,0.01, ***p<0.001, unpaired t-test. Error bars = SEM. All flies were analyzed at day 10 of adulthood.

6 m A writers and readers modify circMbl formation and tau neurotoxicity Having found that circRNAs are methylated to a higher degree in tau transgenic Drosophila and that circMbl is m6A-modified, we next asked if tau-induced elevation of m6A is mechanistically 6 linked to an increase in RNA circularization. In Drosophila, m A deposition on RNA is catalyzed by Mettl3 and Mettl14, while YTHDF1 detects and reads m A to initiate downstream m6A6 dependent RNA handling (Lence et al., 2017). To determine if genetic manipulation of RNA methylation writers and readers mediates circMbl abundance, we genetically reduced or overexpressed Mettl3, Mettl14, and YTHDF in neurons of tauR406W transgenic Drosophila. Panneuronal RNAi-mediated knockdown of Mettl3, Mettl14, or YTHDF significantly reduced circMbl, 6 suggesting that the tau-dependent increase of m A regulates circMbl accumulation. Genetic overexpression of Mettl3, Mettl14, or human YTHDF (hYTHDF) did not alter circMbl levels in 6 brains of tau transgenic Drosophila (Fig. 4A), suggesting that circMbl sites of potential m A addition are already saturated in this model. Levels of transgenic tau protein were unchanged in response to genetic manipulation of m6A readers and writers (Supplemental Fig. 2A, B). As a control for the effects of genetic manipulation of m6A readers and writers on the expression of a normal, linear housekeeping gene, we analyzed levels of ³-tubulin RNA in the context of Mettl3, Mettl14, and YTHDF knockdown and overexpression. ³-tubulin transcript levels were unchanged as a consequence of genetic manipulation of RNA methylation machinery (Fig. 4B), suggesting that the effects of Mettl3, Mettl14, and YTHDF knockdown on circMbl are not a general consequence of widespread changes in transcript levels.

Having found that m6A is elevated in tau transgenic Drosophila and that such elevation is a mechanistic driver of RNA circularization in this model, we next asked if tau-induced increase in RNA methylation causally mediates neurodegeneration. We find that panneuronal reduction of deposition and detection of RNA methylation factors suppresses the tau-induced rough eye 6 phenotype (Fig. 4C), suggesting that tau-induced elevation of m A is neurotoxic. To assess neurodegeneration in the brain directly, we quantified the number of TUNEL-positive cells in brains of tau transgenic Drosophila with and without RNAi-mediated depletion of Mettl3, Mettl14, and YTHDF. In line with our rough eye analyses, we find that genetic reduction of these factors suppresses tau-induced neurodegeneration (Fig. 4D).

6 Figure 4. m A writers and readers are involved in circMbl methylation A. dPCR-based analysis of circMbl levels in Drosophila of the indicated genotype. B. dPCR analysis of ³-tubulin levels in the indicated Drosophila genotypes. C. SEM analysis of the rough eye phenotype in Drosophila of the indicated genotype. D. Quantification of neurodegeneration based on TUNEL staining in Drosophila brains of the indicated genotype. n = 6 biological replicates per genotype. ***p,0.001, ****p<0.0001, ANOVA with a post-hoc Tukey test was used for multiple comparisons. Error bars = SEM. All analyses were performed at day 10 of adulthood.

6

Studies in Drosophila, iPSC-derived neurons, and human disease report the formation of nuclear invaginations and blebs in the context of tauopathy (Frost et al., 2016; Paonessa et al., 2019). As we have previously found that polyadenylated RNA and targets of nonsense-mediated RNA decay accumulate within nuclear invaginations and blebs in tau transgenic Drosophila (Cornelison 6 et al., 2019; Zuniga et al., 2022), we visualized the relationship between circMbl, m A, and nuclear pleomorphisms. Using transmission electron microscopy (TEM), we detect distinct structures within nuclear blebs in brains of tau transgenic Drosophila, the contents of which are unknown (Fig. 5A, Supplemental Fig. 3). We next performed FISH/IF to visualize circMbl with respect to nuclear pleomorphisms. In brains of tau transgenic Drosophila, but not controls, we find that 6 circMbl associates with lamin-lined nuclear blebs (Fig. 5B). Similarly, we detect presence of m A within lamin-positive nuclear blebs in brains of tau transgenic Drosophila (Fig. 5C). FISH/IF-based 6 detection of circMbl and m A reveals frequent colocalization of these factors in the perinuclear region (Fig. 5D). Taken together, these analyses suggest a potential relationship between circRNA, RNA methylation, and nuclear blebbing. the Drosophila brain. A. Example of a nuclear bleb in the brain of tau transgenic Drosophila versus control visualized by TEM. The nucleus and nuclear bleb are artificially colored blue and red, respectively, for visualization. B. CircMbl associates with tau-induced nuclear blebs based on FISH/IF-based detection of circMbl and lamin in the Drosophila brain. Arrow indicates a lamin6 lined nuclear bleb containing circMbl. C. m A within a nuclear bleb of tau transgenic Drosophila

6 based on visualization of m A and lamin. Arrow indicates a lamin-lined nuclear bleb containing m6A. D. Accumulation of circMbl and m A at the nuclear periphery in brains of tau transgenic 6 Drosophila. Arrow indicates an example of colocalization. All flies were analyzed at day 10 of adulthood.

6

We next investigated the incidence of circRNA formation and its relationship with RNA methylation in iPSC-derived neurons and 120-day-old cerebral organoids derived from a patient harboring the frontotemporal dementia-associated tauIVS10+16 MAPT mutation (Janssen et al., 2002) compared to its CRISPR-corrected isogenic control (Karch et al., 2019). We first utilized DCC to quantify circRNAs (Supplemental Dataset 2) in a publicly-available RNA-seq dataset from tauIVS10+16/+ iPSC-derived neurons compared to their CRISPR-corrected isogenic control (Fig. 6A). The human homolog of Drosophila mbl, MBNL1, was not detected in circular form in iPSC-derived 6 neurons. In line with our findings in tau transgenic Drosophila, we find that overall levels of m A are elevated in tauIVS10+16 iPSC-derived cerebral organoids aged to 120 days based on immunofluorescence (Fig. 6B, C). As has been reported for iPSC-derived neurons carrying other MAPT mutations (Paonessa et al., 2019), we also detect an increased incidence of nuclear envelope pleomorphism in 120-day-old tauIVS10+16 organoids based on immunofluorescence (Fig.

Having identified circRNAs that are differentially expressed in tauIVS10+16 iPSC-derived neurons, alongside an increase in m6A, we next visualized the relationship between circRNA, m6A, and nuclear pleomorphisms. We developed FISH probes to detect the back-splice junction of circTet1, a circRNA that was significantly enriched in tauIVS10+16 iPSC-derived neurons based on RNA-seq. FISH-based detection of circTet1 confirms an overall increase of circTet1 in tauIVS10+16 derived cerebral organoids, with clear presence in nuclear invaginations (Fig. 6G and Supplemental Fig. 4A, B). We also find that circTet1 colocalizes with m A in tauIVS10+16 derived 6 cerebral organoids (Fig. 6H). In support of our mechanistic studies in Drosophila, our analyses of human MAPT mutation-carrying brain organoids suggests that tau dysfunction causes differential abundance of circRNAs, elevates RNA methylation, and drives nuclear envelope pleomorphisms 6 that are associated with circRNA and m A. 6 m A modification in iPSC-derived neurons and cerebral organoids with MAPT mutation. A. RNA-seq based identification of differentially expressed circRNAs in tauIVS10+16/+ neurons compared to isogenic control. Dashed line indicates an adjusted p value of 0.05. B. Visualization of m A in tauIVS10+16/+ iPSC-derived organoid and control based on immunofluorescence. C.

6 Quantification of (B). D. Nuclear invagination based on lamin immunofluorescence in tauIVS10+16/+ iPSC-derived cerebral organoids and isogenic controls. E. Quantification of (D). F. TEM images showing large nuclear bleb with inclusion in tauIVS10+16/+ iPSC-derived cerebral organoid. The nucleus and inclusion are artificially colored blue and red, respectively, for visualization. FISH/IFbased detection of G. circTet1 and Lamin B1 or H. m6A in human cerebral organoids. n = 6 replicates. *p<0.5, ***p,0.001, ***p<0.0001, unpaired t-test. Error bars = SEM. Brain organoids were aged to 120 days.

With stable structure and long half-life in cerebrospinal fluid, circRNAs are a recently-proposed new hallmark of aging and potential biomarkers for neurodegenerative disorders (Gruner et al., 2016; Shao & Chen, 2016; Gokool et al., 2020). While circRNA dysregulation has been reported in age-associated neurological disorders including inflammatory neuropathy (Shao & Chen, 2016), Parkinson's disease (Hanan et al., 2020) and Alzheimer9s disease (Dube et al., 2019), the association between pathogenic tau and circRNA biogenesis was previously unexplored. In the current study, we utilize a well-characterized Drosophila model of tauopathy and iPSC-derived 6 neurons and cerebral organoids to discover a novel link between tau, m A RNA methylation, circRNA biogenesis, nuclear pleomorphism and neurotoxicity.

We find that overall levels of circRNAs are elevated in tau transgenic Drosophila and that RNAi-mediated reduction of circMbl significantly suppresses tau neurotoxicity. While it is currently unknown how circMbl exerts toxicity in tau transgenic Drosophila, previous studies report that circRNAs can impact cellular function by competing with linear RNA splicing (Ashwal-Fluss et al., 2014), by serving as a sponge for complementary short and long RNAs and RNA binding proteins (Hansen et al., 2013; Memczak et al., 2013; Memczak et al., 2015), and by active translation into protein via cap-independent translation (Wang & Wang, 2015).

6 We became interested in m A modification as a potential mechanism driving tau-induced 6 circRNA formation based on previous studies reporting that differential m A modification at specific sites is sufficient to alter the fate of a nascent RNA from its canonical splicing pattern to back-splicing and consequent circularization, and that the back-splicing rate of m6A-modified exons is significantly elevated compared to their unmethylated counterparts (Di Timoteo et al., 6 2020). The m A modification occurs co-transcriptionally and is the most abundant and reversible RNA modification in eukaryotes (Desrosiers et al., 1974; X. Jiang et al., 2021). Writers, readers 6 and erasers of m A modification dynamically edit RNAs and affect RNA splicing, export, translation and clearance (X. Jiang et al., 2021). We find that transgenic expression of human tau causes an overall increase of m6A in the brain, that circRNA is m A modified to a greater extent 6 6 in brains of tau transgenic Drosophila, and that panneuronal RNAi-mediated depletion of m A readers and writers (Mettl3, Mettl14 and YTHDF) reduce circMbl content in tau transgenic Drosophila.

As a previous study utilizing transgenic expression of R406W mutant tau in the Drosophila eye reported exacerbation of the tau-induced rough eye phenotype upon RNAi-mediated knockdown of Mettl3, Mettl14 and YTHDF (Shafik et al., 2021), we were surprised to find robust suppression of the tau-induced rough eye and a decrease in TUNEL-positive cells per brain in response to panneuronal knockdown of these m6A regulators in Drosophila with panneuronal expression of tauR406W. We would not expect such discrepancy between our respective analyses despite minor differences in our approach 3 use of a panneuronal driver in our study rather than eye-specific transgene expression, for example, or our quantification of neurotoxicity via TUNEL rather than relying on the rough eye phenotype alone. Our findings do nevertheless align with 6 recent work reporting an overall increase in m A in brains of tau transgenic mice and with associated stress granules in HEK293T cells and rat primary cortical neurons (Casci et al., 2019). Studies in myotonic dystrophy, however, point toward loss of MBNL1 function as a disease mechanism. MBNL1 deposits within nuclear inclusions in this disorder due to its binding to CUG repeat expansions in mRNA transcripts of dystrophia myotonica protein kinase, thus reducing MBNL1 function as a splicing factor (Miller et al., 2000). Our work adds tauopathy to the list of neurological disorders that may be associated with mbl dysfunction and point toward increased 6 m A methylation and circularization of the mbl transcript as a mechanism driving disease. While it is currently unknown if circularization of muscleblind transcripts are involved in FUS-associated neurotoxicity or in various neurological disorders involving nucleotide repeat expansion, our investigations into circMbl and tau neurotoxicity provide strong rationale for investigating MBNL1 transcript circularization in these disorders, as well as in the adult human brain affected by tauopathy.

Taken together, we have discovered a toxic link between tau, elevated levels of RNA methylation, and formation of circRNAs.

While the current study utilizes two different frontotemporal dementia-associated mutations of human tau, the presence of nuclear envelope pleomorphisms alongside the dysregulation of circRNA and RNA methylation previously reported in human Alzheimer9s disease and other models of tauopathy (Frost et al., 2016; Cornelison et al., 2019; Dube et al., 2019; L. Jiang et al., 2021) suggests that our findings are likely not a restricted to the R406W or IVS10+16 MAPT mutations. In future work, it will be of interest to 6 further define the role of m A-mediated circRNA formation, nuclear export, and translation in the setting of sporadic primary and secondary tauopathy.

Human iPSC lines were obtained from the Tau Consortium cell line collection (https://www.neuralsci.org/tau) (Karch et al., 2019). All iPSC lines were maintained in complete mTeSR1 (#85850; Stem Cell Technology) growth medium on Corning® Matrigel® hESCQualified Matrix (#354277; Corning) and passaged every 3-5 days using ReLeSR# (#05872; Stem Cell Technology).

>

Cortical organoids were generated as previously described (Pa_ca et al., 2015) with minor modifications. iPSC cultures at 80% confluency were detached from plates using ReLeSR#, the cell pellet was mixed gently with STEMdiff# Neural Induction Medium (NIM)+1µl/ml ROCK inhibitor Y-27632 (#72302; Stem Cell Technology) and plated at 3x106 cell density per well into Nunclon Sphera 96 U bottom plates (#174929; Thermo Fisher Scientific) and incubated at 37 °C with 5% CO2. From days 2-6, fresh NIM media supplemented with dorsomorphin (#P5499; SigmaAldrich) and SB-431542 (#1614; Tocris) were added ot cells daily. From days 7-24, spheroids were fed every other day with STEMdiff# Neural Progenitor Medium (#05833; Stem Cell Technology). After day 23, media was replaced every other day with neuronal differentiation media prepared based on the Stem Cell Technology protocol: 10 ml of the BrainPhys# Neuronal Medium (#05790; Stem Cell Technology) supplementedwith 200 µl of NeuroCultTM SM1 Neuronal Supplement (#05711; Stem Cell Technology),200 µl of N2 Supplement-A (#07152; Stem Cell Technology), 20 ng/ml Human Recombinant BDNF (#78005; Stem Cell Technology), 20 ng/ml Human Recombinant GDNF (#78058; Stem CellTechnology), 1 mM Dibutyryl-cAMP (#73882; Stem Cell Technology) and 200 nM AscorbicAcid (#72132; Stem Cell Technology). From day 43 to 120, spheroids were fed every four days with BrainPhys# Neuronal Medium.

Drosophila. Total RNA sequencing data from 10-day old Drosophila transgenic tauR406W vs control heads (GSE152278) were aligned to the Drosophila melanogaster genome (Version 6.50) with STAR v2.7.1a (--chimSegmentMin 15 and --chimJunctionOverhangMin 15). CircRNAs were identified and quantified with DCC v0.50 (Cheng et al., 2016) with Flybase gene annotations (v6.50), RepeatMasker and UCSC simple repeat filtered annotation file using default parameters. Detected circRNAs and other transcripts were then tested for differential expression using DESeq2 v1.34. Differentially expressed circRNAs with an adjusted p value less than 0.05 were considered statistically significant. Sequencing data are provided in Supplemental Dataset 1. iPSC-derived neurons. Fastq files were aligned to the GRCh38 genome with STAR v2.7.1a (-chimSegmentMin 15 and --chimJunctionOverhangMin 15). CircRNAs were identified and quantified with DCC v0.50 (Cheng et al., 2016) with RepeatMasker and UCSC simple repeat filtered annotation file using default parameters. Detected circRNAs and transcripts were then tested for differential expression using DESeq2 v1.34. Differentially expressed circRNAs with an FDR less than 0.05 were considered statistically significant. Sequencing data are provided in

Absolute RNA levels of mbl, circMbl and tubulin were assessed using the Applied Biosystems QuantStudio 3D dPCR system. For RNA extraction, six fly heads (three males and three females) were homogenized in TRIzol (Invitrogen) and RNA was extracted according to the manufacturer's protocol. RNA concentrations were measured using a Nanodrop8000 spectrophotometer (ThermoFisher Scientific). Equal quantities of RNA were added to a reverse transcription reaction (cDNA Reverse Transcription Kit, Applied Biosystems). Resulting cDNA was loaded into a dPCR chip, sealed, and amplified prior to calculating the absolute RNA concentration in copies/¿L. Probes for linear mbl and tubulin mRNA were predesigned by ThermoFisher Scientific. The circMbl probe was designed to recognize the junction between the 59 and 39 ends of the RNA using the Custom TaqMan® Assay Design Tool (Supplemental Table 3).

One Drosophila head per lane was homogenized in 2X Laemmeli buffer (Bio-Rad) and boiled for 10 minutes. Protein was separated via 10% SDS-PAGE and transferred to nitrocellulose membranes. Membranes were incubated overnight at 4 °C with primary antibodies (Supplemental Table 4). After washing with PBS+0.1% Tween (PBSTw), membranes were incubated with HRP-conjugated secondary antibodies for two hours at room temperature and developed with ClarityTM Western ECL substrate. Images were acquired using the ChemiDocTM imaging system (Bio-Rad), after which FIJI was used to quantify signal intensity.

Frozen OCT-embedded Drosophila heads were sectioned at 10 ¿m, placed on glass slides, and fixed with 4% PFA for 10 minutes. Tissue was incubated in pre-hybridization buffer (2X SSC, 10% dextran sulfate, 20 mM ribonucleoside vanadyl complex (RVC), 20% formamide) for 15 minutes at room temperature. Digoxigenin (DIG) labeled circMbl and Quasar®670-labeled circTet1 probes (Supplemental Table 5) were mixed with hybridization buffer (4X SSC, 20% dextran sulfate, 40 mM RVC) at 2 ng/µl concentration and incubated for three hours at 37 ¡C followed by three 10-minute washes in 2X SSC at 37 °C. Sections were then incubated with anti-DIG (Invitrogen) with 20 mM of RVC for one hour at 37 ¡C and washed briefly with PBS + 0.2% Triton X 100 (PBSTr). Preparations were fixed in 4% paraformaldehyde for 10 minutes and washed three times in PBSTr for 10 minutes each followed by overnight incubation with antibodies detecting lamin (lamin R-836 (Osouda et al., 2005), and m6A at 4 °C. Samples were then incubated with AlexaFluor#-conjugated secondary antibodies for two hours at room temperature and briefly rinsed with PBSTr and mounted with DAPI (Southern Biotech).

For visualization of lamin and m6A in Drosophila brains, we utilized formalin fixed, paraffin embedded Drosophila heads sectioned at 4 ¿m. Sections were rehydrated and then subjected to antigen retrieval via microwaving in 1 mM of sodium citrate for 20 minutes. Slides were blocked with 2% BSA in PBSTr and incubated with primary antibodies overnight at 4 °C. Slides were washed again prior to incubation with AlexaFluor-conjugated secondary antibodies for two hours at room temperature. Samples were visualized using a Zeiss confocal microscope.

Fly heads or iPSC-derived organoids were fixed in phosphate buffered 4% formaldehyde and 1% glutaraldehyde for at least two hours followed by osmium tetroxide treatment for 30 minutes. The samples were then dehydrated through a graded series of ethanol. For Scanning Electron Microscopy (SEM), samples were treated with hexamethyldisilazane and air dried before sputter coated with gold/palladium. For Transmission Electron Microscopy (TEM), each piece was embedded with resin in a flat mold for correct orientation and then polymerized in an 85 ¡C oven overnight. Images were captured using JEOL JSM 6610LV and JEOL 1400 for SEM and TEM, respectively.

The Drosophila locomotor assay was performed as previously described (Frost et al., 2016). Briefly, Drosophila were individually transferred into a new vial at day nine of adulthood. On day 10, vials were placed on a grided surface, and the number of centimeters walked in 30 seconds was quantified. 18 flies per genotype were analyzed. Investigators were blinding to genotype.

Formalin-fixed, paraffin embedded Drosophila heads were sectioned at 4 ¿m. TdT Colorimetric FragEL DNA Fragmentation Detection Kit (QIA33 TdT FragEL; Calbiochem) was used for TUNEL staining. Diaminobenzidine was used for secondary detection of biotin-labeled deoxynucleotides at exposed ends of DNA fragments per the manufacturer9s recommendation. Brightfield microscopy was used to quantify TUNEL-positive neurons throughout the entire fly brain. Investigators were blinded to genotype.

RNA was extracted as described above and was serially diluted to 25, 12.5, 6.25 ng/µl. Samples were loaded on a positively charged nylon membrane (Bright Star-Plus; Invitrogen) and UV crosslinked using Stratagene Stratalinker 1800. Membranes were washed briefly with PBSTw and blocked in PBSTw plus 2% dry milk for 30 minutes followed by overnight incubation with the 6 m A antibody at 4 °C. The membrane was then incubated with an HRP-conjugated secondary antibody for two hours at room temperature and developed with ClarityTM Westrern ECL substrate (Bio-Rad). Images were acquired using the ChemiDocTM imaging system (Bio-Rad), after which FIJI was used to quantify signal intensity.

Me-RIP RNA was extracted as described above from 80 Drosophila heads (40 females and 40 males).

6 m A enrichment was performed using the EpiQuik CUT&RUN m6A RNA Enrichment (MeRIP) Kit (#P-9018-24, EPIGENTEK) based on the manufactuerr protocol and 20 µg (m6A enriched) or 200 ng (input) of RNA per sample. m6A enriched and input RNAs were eluted in nuclease free water for further cDNA preparation and dPCR analysis.

RNA was extracted from 12 Drosophila heads as described above. 2 µg of RNA per sample was digested using one unit of RNase R and 2 µl of 10X RNase R buffer (#RNR07250, Bioresearch Technologies) in a 20 µl reaction at 37 ¡C for 10 minutes. The resulting circRNA was then subjected to analysis via dot blot as described above.

We considered P < 0.05 significant based on a student9s t-test andANOVA followed by Tukey9s test when making single or multiple comparisons, respectively. Unless otherwise noted, statistical analyses were performed using GraphPad Prism 9.1. Based on power analysis and our previous studies, we used n = 6 biological replicates per condition for immunostaining, FISH/IF and Western blotting, n = 12 for digital PCR, and n = 18 for locomotor activity. When possible, samples were randomized and visual scoring was performed blindly for all immunofluorescence, TUNEL and locomotor assays.

This study was supported by R01 AG057896-04 (BF) and T32 AG021890 (FA) from the National Institute on Aging and RF1 NS110890 (CMK) from the National Institute of Neurological Disorders and Stroke.

We thank Drs. Sebastian Kadener and Nagarjuna Pamudurti, Brandeis University, for providing the circMblKD Drosophila stock and Dr. Mel Feany for providing UAS-tauR406W Drosophila. All other Drosophila stocks were obtained from the Bloomington Drosophila Stock Center (NIH P40OD018537). The actin antibody (JLA20) developed by Lin, J.J.-C (Lin, 1981) was obtained from the Developmental Studies Hybridoma Bank, created by the NICHD of the NIH and maintained at The University of Iowa, Department of Biology, Iowa City, IA 52242.

The study was conceptualized by FA and BF. FA, JD, EG and MM performed experiments. FA and PR completed data analysis. BF and FA participated in study design, figure and manuscript preparation. MM and CK provided RNA-seq data for iPSC-derived neurons prior to publication and deposition of this data in the Synapse repository.

reduction of circMbl or mbl. reduction of Mettl3 and YTHDF.

Supplemental Figure 1. Tau protein levels in tauR406W transgenic Drosophila with panneuronal Supplemental Figure 2. Tau protein levels in tauR406W transgenic Drosophila with panneuronal Supplemental Figure 3. Nuclear bleb formation increases in neurons of tau transgenic Drosophila. Supplemental Figure 4. Elevated levels of circTet1 in cortical brain organoids with MAPT mutation.

Supplemental Table 1. Drosophila genotypes.

Supplemental Table 2. dPCR target sequence and RNA FISH probes. Supplemental Table 3. List of antibodies, concentrations and sources.

Supplemental Dataset 1. CircRNA analysis of control versus tauR406W heads. Supplemental Dataset 2. CircRNA analysis of IVS10+16/+ vs. +/+ iPSC-derived neurons.

R406W transgenic

Drosophila with panneuronal reduction of circMbl or mbl. A. Tau protein levels in total head lysates from tauR406W, tau+circMblKD and tau+MblRNAi Drosophila. B. Quantification of (C). n = 6 biological replicates per genotype. **p < 0.01, ****p < 0.0001, ANOVA with a post-hoc Tukey test was used for multiple comparisons. All assays were performed at day 10 of adulthood. Error bars = SEM.

Drosophila. A nuclear bleb containing a large inclusion in the brain of tau transgenic Drosophila versus control visualized by TEM showed in upper panel. Lower panel represents a protruding bleb in tau transgenic brain. The nucleus and inclusion are artificially colored blue and red, respectively, for visualization. All flies were 10 days old.

mutation. A. Visualization of circTet1 in tauIVS10+16/+ iPSC-derived cerebral organoid vs. isogenic control based on FISH. B. Quantification of circTet1 levels in (A). **p<0.01, unpaired t-test.

Control Tau

Elav-GAL4: BDSC 458

CircMbl (dPCR) dPCR target sequence/RNA FISH probes CircMbl (FISH probe) Quasar® 670 dye CircTet1 (FISH probes) tttccgccgatctcttgatg aacttacaactgtgggcttc cgcatattgtgccatacata ttttcccaaatacagtagga ttccatattttggtcgagga tgcataatggacctcgtttg ttatctgagtgagtggtgga gattcaggatatctctgtaa aaccttcaccttttcctctg agctgagtgaatccaatggt cgttggattccgttttaaga agctttatcagtgaatgcct ccgttaactgtacctgagaa atgggctttctgattggcat cacgttagcacactggttag aaaccgtatttggtcatcgc tgagttgctccttaacaacc aatgttggcagtctctgatg tgtttcatgagagataccag ttagtgctgactccggtaag cactacatttacattcctga tctgatgttccaaaactgga aatttttctgtgcactgtcc agaagttcatggcataatca aggttttttgtagggttagt aatttttgttcttccccatg caacagtatgtgggttcaat aatctcctttcacgtgatca gtttaatgccatttcttacg caatgtcttgccgaattctt taaaacgttacttctcccct taaagccaggctgctggaat ccttcattgtgtatactagc tctcaggagtttttggttga tctatggctaccacttgctc cttctgagagttgagtcagg gctttgcagctattaagcaa cttttcttacagtgtagagg ctgtaagtttgggtcttgga gattaagttttggtggctct

Actin Lamin R836 Lamin B1 Digoxigenin Tau HRP HRP 1:1000 1:2,000,000 1:20,000 1:20,000 1:200 1:100 1:1,000 1:100 1:200 1:200 1:1,000

DSHB# JLA29 Abcam 151230 Dako A0024 Invitrogen A21424 Invitrogen A11008 Southern Biotech 1010-5 Southern Biotech 3010-5

Apicco, D. J., Zhang, C., Maziuk, B., Jiang, L., Ballance, H. I., Boudeau, S., . . . Wolozin, B. (2019). Dysregulation of RNA Splicing in Tauopathies. Cell Rep, 29(13), 4377-4388 e4374. https://doi.org/10.1016/j.celrep.2019.11.093 Ashwal-Fluss, R., Meyer, M., Pamudurti, N. R., Ivanov, A., Bartok, O., Hanan, M., . . . Kadener, S. (2014). circRNA biogenesis competes with pre-mRNA splicing. Mol Cell, 56(1), 55-66. https://doi.org/10.1016/j.molcel.2014.08.019 Bardai, F. H., Wang, L., Mutreja, Y., Yenjerla, M., Gamblin, T. C., & Feany, M. B. (2018). A Conserved Cytoskeletal Signaling Cascade Mediates Neurotoxicity of FTDP-17 Tau Mutations. J Neurosci, 38(1), 108-119. https://doi.org/10.1523/JNEUROSCI.155017.2017 Braak, H., Thal, D. R., Ghebremedhin, E., & Del Tredici, K. (2011). Stages of the pathologic process in Alzheimer disease: age categories from 1 to 100 years. J Neuropathol Exp Neurol, 70(11), 960-969. https://doi.org/10.1097/NEN.0b013e318232a379 Casci, I., Krishnamurthy, K., Kour, S., Tripathy, V., Ramesh, N., Anderson, E. N., . . . Pandey, U. B. (2019). Muscleblind acts as a modifier of FUS toxicity by modulating stress granule dynamics and SMN localization. Nat Commun, 10(1), 5583.

https://doi.org/10.1038/s41467-019-13383-z Cheng, J., Metge, F., & Dieterich, C. (2016). Specific identification and quantification of circular RNAs from sequencing data. Bioinformatics, 32(7), 1094-1096.

https://doi.org/10.1093/bioinformatics/btv656 Cornelison, G. L., Levy, S. A., Jenson, T., & Frost, B. (2019). Tau-induced nuclear envelope invagination causes a toxic accumulation of mRNA in Drosophila. Aging Cell, 18(1), e12847. https://doi.org/10.1111/acel.12847 Daughters, R. S., Tuttle, D. L., Gao, W., Ikeda, Y., Moseley, M. L., Ebner, T. J., . . . Ranum, L.

P. (2009). RNA gain-of-function in spinocerebellar ataxia type 8. PLoS Genet, 5(8), e1000600. https://doi.org/10.1371/journal.pgen.1000600 de Haro, M., Al-Ramahi, I., De Gouyon, B., Ukani, L., Rosa, A., Faustino, N. A., . . . Botas, J. (2006). MBNL1 and CUGBP1 modify expanded CUG-induced toxicity in a Drosophila model of myotonic dystrophy type 1. Hum Mol Genet, 15(13), 2138-2145.

https://doi.org/10.1093/hmg/ddl137 Desrosiers, R., Friderici, K., & Rottman, F. (1974). Identification of methylated nucleosides in messenger RNA from Novikoff hepatoma cells. Proc Natl Acad Sci U S A, 71(10), 39713975. https://doi.org/10.1073/pnas.71.10.3971 Di Timoteo, G., Dattilo, D., Centron-Broco, A., Colantoni, A., Guarnacci, M., Rossi, F., . . .

Bozzoni, I. (2020). Modulation of circRNA Metabolism by m(6)A Modification. Cell Rep, 31(6), 107641. https://doi.org/10.1016/j.celrep.2020.107641 Dias-Santagata, D., Fulga, T. A., Duttaroy, A., & Feany, M. B. (2007). Oxidative stress mediates tau-induced neurodegeneration in Drosophila. J Clin Invest, 117(1), 236-245.

https://doi.org/10.1172/JCI28769 Dube, U., Del-Aguila, J. L., Li, Z., Budde, J. P., Jiang, S., Hsu, S., . . . Cruchaga, C. (2019). An atlas of cortical circular RNA expression in Alzheimer disease brains demonstrates clinical and pathological associations. Nat Neurosci, 22(11), 1903-1912.

https://doi.org/10.1038/s41593-019-0501-5 Dubin, D. T., & Taylor, R. H. (1975). The methylation state of poly A-containing messenger RNA from cultured hamster cells. Nucleic Acids Res, 2(10), 1653-1668. https://doi.org/10.1093/nar/2.10.1653 tissue differentiation rather than obvious nuclear shape distortion or specific defects during cell proliferation. Dev Biol, 284(1), 219-232.

https://doi.org/10.1016/j.ydbio.2005.05.022 Pamudurti, N. R., Bartok, O., Jens, M., Ashwal-Fluss, R., Stottmeister, C., Ruhe, L., . . .

Kadener, S. (2017). Translation of CircRNAs. Mol Cell, 66(1), 9-21.e27.

https://doi.org/10.1016/j.molcel.2017.02.021 Pamudurti, N. R., Patop, I. L., Krishnamoorthy, A., Bartok, O., Maya, R., Lerner, N., . . .

Kadener, S. (2022). circMbl functions in cis and in trans to regulate gene expression and physiology in a tissue-specific fashion. Cell Rep, 39(4), 110740.

https://doi.org/10.1016/j.celrep.2022.110740 Paonessa, F., Evans, L. D., Solanki, R., Larrieu, D., Wray, S., Hardy, J., . . . Livesey, F. J. (2019). Microtubules Deform the Nuclear Membrane and Disrupt Nucleocytoplasmic Transport in Tau-Mediated Frontotemporal Dementia. Cell Rep, 26(3), 582-593 e585. https://doi.org/10.1016/j.celrep.2018.12.085 Pa_ca, A. M., Sloan, S. A., Clarke, L. E., Tian, Y., Makinson, C. D., Huber, N., . . . Pa_ca, S. P. (2015). Functional cortical neurons and astrocytes from human pluripotent stem cells in 3D culture. Nat Methods, 12(7), 671-678. https://doi.org/10.1038/nmeth.3415 Perry, R. P., Kelley, D. E., Friderici, K., & Rottman, F. (1975). The methylated constituents of L cell messenger RNA: evidence for an unusual cluster at the 5' terminus. Cell, 4(4), 387394. https://doi.org/10.1016/0092-8674(75)90159-2 Poorkaj, P., Bird, T. D., Wijsman, E., Nemens, E., Garruto, R. M., Anderson, L., . . .

Schellenberg, G. D. (1998). Tau is a candidate gene for chromosome 17 frontotemporal dementia. Ann Neurol, 43(6), 815-825. https://doi.org/10.1002/ana.410430617 Rudnicki, D. D., Holmes, S. E., Lin, M. W., Thornton, C. A., Ross, C. A., & Margolis, R. L. (2007). Huntington's disease--like 2 is associated with CUG repeat-containing RNA foci.

Ann Neurol, 61(3), 272-282. https://doi.org/10.1002/ana.21081 Salzman, J., Chen, R. E., Olsen, M. N., Wang, P. L., & Brown, P. O. (2013). Cell-type specific features of circular RNA expression. PLoS Genet, 9(9), e1003777.

https://doi.org/10.1371/journal.pgen.1003777 Sellier, C., Rau, F., Liu, Y., Tassone, F., Hukema, R. K., Gattoni, R., . . . Charlet-Berguerand, N. (2010). Sam68 sequestration and partial loss of function are associated with splicing alterations in FXTAS patients. EMBO J, 29(7), 1248-1261.

https://doi.org/10.1038/emboj.2010.21 Shao, Y., & Chen, Y. (2016). Roles of Circular RNAs in Neurologic Disease. Front Mol Neurosci, 9, 25. https://doi.org/10.3389/fnmol.2016.00025 Shafik, A. M., Zhang, F., Guo, Z., Dai, Q., Pajdzik, K., Li, Y., Kang, Y., Yao, B., Wu, H., He, C., Allen, E. G., Duan, R., & Jin, P. (2021, Jan 05). N6-methyladenosine dynamics in neurodevelopment and aging, and its potential role in Alzheimer's disease. Genome Biol, 22(1), 17. https://doi.org/10.1186/s13059-020-02249-z Sohn, C., Ma, J., Ray, W. J., & Frost, B. (2023). Pathogenic tau decreases nuclear tension in cultured neurons. Front Aging, 4, 1058968. https://doi.org/10.3389/fragi.2023.1058968 Speese, S. D., Ashley, J., Jokhi, V., Nunnari, J., Barria, R., Li, Y., . . . Budnik, V. (2012). Nuclear envelope budding enables large ribonucleoprotein particle export during synaptic Wnt signaling. Cell, 149(4), 832-846. https://doi.org/10.1016/j.cell.2012.03.032 Spillantini, M. G., Murrell, J. R., Goedert, M., Farlow, M. R., Klug, A., & Ghetti, B. (1998).

Mutation in the tau gene in familial multiple system tauopathy with presenile dementia.

Proc Natl Acad Sci U S A, 95(13), 7737-7741. https://doi.org/10.1073/pnas.95.13.7737 Tanabe, L. M., Liang, C. C., & Dauer, W. T. (2016). Neuronal Nuclear Membrane Budding Occurs during a Developmental Window Modulated by Torsin Paralogs. Cell Rep, 16(12), 3322-3333. https://doi.org/10.1016/j.celrep.2016.08.044

Wang, Y., & Wang, Z. (2015). Efficient backsplicing produces translatable circular mRNAs.

RNA, 21(2), 172-179. https://doi.org/10.1261/rna.048272.114 Wittmann, C. W., Wszolek, M. F., Shulman, J. M., Salvaterra, P. M., Lewis, J., Hutton, M., & Feany, M. B. (2001). Tauopathy in Drosophila: neurodegeneration without neurofibrillary tangles. Science, 293(5530), 711-714. https://doi.org/10.1126/science.1062382 Yang, Y., Fan, X., Mao, M., Song, X., Wu, P., Zhang, Y., . . . Wang, Z. (2017). Extensive translation of circular RNAs driven by N. Cell Res, 27(5), 626-641.

https://doi.org/10.1038/cr.2017.31 Zhou, C., Molinie, B., Daneshvar, K., Pondick, J. V., Wang, J., Van Wittenberghe, N., . . .

Mullen, A. C. (2017). Genome-Wide Maps of m6A circRNAs Identify Widespread and Cell-Type-Specific Methylation Patterns that Are Distinct from mRNAs. Cell Rep, 20(9), 2262-2276. https://doi.org/10.1016/j.celrep.2017.08.027 Zhou, M., Xiao, M. S., Li, Z., & Huang, C. (2021). New progresses of circular RNA biology: from nuclear export to degradation. RNA Biol, 18(10), 1365-1373.

https://doi.org/10.1080/15476286.2020.1853977 Zuniga, G., Levy, S., Ramirez, P., De Mange, J., Gonzalez, E., Gamez, M., & Frost, B. (2022).

Tau-induced deficits in nonsense-mediated mRNA decay contribute to neurodegeneration. Alzheimers Dement. https://doi.org/10.1002/alz.12653