C2C12 cells were procured from the Duke Cell Culture Facility. They were maintained at 37°C and 5% CO2 on growth media (GM) for C2C12 comprised of DMEM (Gibco 11965092), 10% heat-inactivated fetal bovine serum (Sigma-Aldrich F2442), and 1X pneicillin-streptomycin (Gibco 15140163). For differentiation induction, cells were seeded at a density of 1.25E5 cells/well in a 6-well plate and allowed to proliferate for 48 hours in GM to reachconfluence. Post confluence, the culture medium was switched to differentiation media (DM), which consisted of DMEM without methionine, cystine-2HCl, and glutamine (Gibco 21013024), supplemented with 2% heat-inactivated horse serum (Hyclone SH30074.03), 1X pen/strep (Gibco 15140163), and 1Mµ insulin (Sigma-Aldrich I6634). Both cystine-2HCl and glutamine were reintroduced to levels found in standard DMEM. Depending on the experimental conditions, methionine was either added to a concentration of 200 µM (for control) or to other specified concentrations. The differentiation process was allowed to proceed for 5 days, with media changes occurring every 48 hours.

Images of C2C12 cells were acquired using a Leica DM IL LED microscope, which was outfitted with a Leica MC170HD camera. Imaging was performed using 20x, 10x, and 4x objectives, and images were captured and processed using the LAS EZ software. A convolutional neural network (CNN) was trained using the ResNet-18 architecture with PyTorch25,26. We modified ResNet-18 by replacing its final fully connected layer to yield a single continuous output value. 64 images, captured using the 10x objective,were obtained each day from Day 0 (D0) to Day 5 (D5) for cells exposed to differentiation media (DM) containing full methionine. To augment our dataset, each of these images was subdivided into five sub-images. For labeling, each image was assigned a numeric value corresponding to the day; e.g., an image of a Day 3 (D3) cell received a label of 3.0. Out of the 320 augmented images obtained each day, 270 of them were used for training while the remaining 50 of them served as the test set. The CNN was trained for 15 epochs using a learning rate of 1e-4, utilizing the Mean Squared Error Loss (nn.MSELoss) as the criterion, and Adam as the optimizer. To ascertain the differentiation score of a given image relative to image of cells on a control condition4in which cells differentiated over an identical duration4each image was partitioned into five sub-images and assessed five times. Subsequent results were normalized to the average score of the control group.

Cells were washed twice with room-temperature PBS before being scraped into ice-cold Triton extraction buffer (TEB) containing 0.5% Triton X-100, 0.2% NaN3, and 2 mM PMSF in PBS. The suspension was transferred to a 1.5 ml centrifuge tube and briefly vortexed, followed by a 10-minute incubation on ice. The cells were then centrifuged at 12,000 g at 4°C for 10 minutes. After discardingthe supernatant, the cell pellet was resuspended in 500 µl of TEB and centrifuged again using the same parameters. The supernatant was removed, and the cell pellet was resuspended in 500 µl of 0.2N HCl, which was then incubated at 4°C overnight. The nextday, the samples were centrifuged at 12,000 g at 4°C for 10 minutes. The supernatant was collected,neutralized with 2M NaOH, and their concentrations were determined using a BCA assay.

Cells were rinsed twice with room-temperature PBS and subsequently scraped into ice-cold RIPA buffer (Sigma-Aldrich R0278) supplemented with a 1x Protease Inhibitor Cocktail (Roche 11836170001). After transferring the cell suspension to a 1.5 ml centrifuge tube, it was briefly vortexed and then incubated on a nutator at 4°C for 25 minutes. Following incubation, the cells were centrifuged at 12,000 g at 4C° for 25 minutes. The supernatant was carefully collected, and protein concentrations were quantified using a BCA assay.

Samples were diluted to the desired concentrations (4 mg/well for histone and 15 mg/well for total protein extracts) using water and combined with Laemmli sample buffer containing 10% 2Mercaptoethanol. This mixture was heated at 95°C fo r 5 minutes. The samples were subsequently subjected to electrophoresis on 12% SDS-PAGE gels for histone samples and 4-15% SDS-PAGE gels for total protein extracts, after which they were transferred onto PVDF membranes (Bio-Rad 1704156).The membranes were blocked using 5% BSA (Rockland BSA-50) in TBS-T buffer for an hour, then probed overnight at 4ºC with primary antibodies, all diluetd 1:1000: Myosin Heavy Chain (R&D System mAB4470), ActB (CST 8457T), Histone H3 (CST 96C10H),3K36me3 (Active Motif 61101), H3K27me3 (Active Motif 61018), H3K9me3 (Abcam ab8898), H3K4m e3 (Active Motif 39060), and Setd2 (CST E4WQ8). After overnight incubation, membranes werewashed three times with TBS-T, each for 5 minutes. This was followed by a one-hour incubation at room temperature with peroxidase-conjugated Rabbit or Mouse secondary antibodies (Rockland 610-1302 and 611-7302) at a dilution of 1:10000. Postincubation, membranes underwent another set of three washes with TBS-T, each lasting 5 minutes.

Membranes were then exposed to the ECL substrate kit (Pierce 34850 and 34095) for 3 minutes before imaging with the ChemiDoc Touch Imaging System (Bio-Rad).

Cell culture medium was quickly removed before adding 1 ml of an 80% methanol/water solvent (Fisher Scientific A456 and W6), cooled to 280°C, to each well of the six-well plates. These plates were then chilled at 280°C for 15 minutes. After this, the cells were scraped into the solvent while on dry ice, and the extracts were centrifuged at 20,000g at 4°C for10 minutes. The solvent was then evaporated using a speed vacuum and the dried metabolites pallets were stored at -80ºC.

Dried metabolites pallets were reconstituted in 15 ¿l of H2O, followed by the addition of 15 ¿l of a 1:1 v/v methanol/acetonitrile mix (Fisher Scientific A456 and A955). The samples were then centrifuged at 20,000g at 4°C for 10 minutes, after which the supernatants were moved to LC vials, preparing them for a 3 ¿l HPLC injection. The compounds were separated at room temperature using an XBridge amide column (Waters 100 × 2.1 mm i.d., 3.5 ¿m;) on a Thermo Scientific UltiMate 3000 UHPLC system. Mobile phases and flow rate was configured as described in previous study27.

The Q Exactive Plus mass spectrometer (Thermo Fisher Scientific) was equipped with a heated electrospray ionization probe and configured with the following settings: heater temperature at 120°C; sheath gas flow rate at 30; auxiliary gas at 10; and sweep gas at 3. The spray voltage was set to 3.6 kV in positive mode and 2.5 kV in negative mode. The capillary temperature and S-lens were maintained at 320°C and 55, respectively. Scans were conducted across a range of 60 to 900 m/z at a resolution of 70,000. The automated gain control (AGC) was targeted at 3E6 ions.

The acquired raw LC-MS data were analyzed using Thermo Scientific Sieve 2.0 software, with peak alignment and detection executed as per the manufacturer's guidelines. For targeted metabolite analysis in positive mode, a frame seed encompassing 194 metabolites was utilized, whereas a frame seed comprising 262 metabolites was adopted for the negative mode. The m/z width was set at 10 ppm for both modes. Subsequently, peak integration values were exported. Sample values were normalized based on the mean value of the control group.

RNA was extracted using the Qiagen RNeasy Micro Kit in accordance with the manufacturer's instructions. The quality and quantity of the RNA were determined using NanoDrop (Thermo Scientific). Subsequently, 1 µg of RNA was reverse transcribed into single-stranded complementary DNA utilizing the SuperScript III First-Strand Synthesis SuperMix for qRT-PCR from Invitrogen. Quantitative analysis was carried out on a CFX384 system (Bio-Rad) usingthe iQ SYBR Green Supermix (Bio-Rad) as directed by the manufacturer.

Lentivirus containing GFP or truncated Setd2, obtained from Vectorbuilder, was used to transduce C2C12 cells. Cells were seeded in a 12-well plate at a density of 0.45E5 cells per well and allowed to proliferate for 24 hours, reaching approximately 1E5 cells per well. For the transduction, 100 µl of lentivirus (1E8 TU) was combined with 300 µl of fresh growth media containing polybrene at 5 µg/ml.

After removing the existing cell culture medium, cells were cultured with the 400 µl of lentiviruscontaining media for 24 hours. The following day, cells were transferred to a 10 cm culture dish. Subsequently, puromycin was added at a concentration of 3 µg/ml to initiate the selection process. After 24 hours, surviving cells were relocated to a12-well plate without puromycin. These cells were then incrementally transferred first to a 6-well plate and later to a 10 cm plate. A final round of selection was done by reintroducing puromycin. The expression levels of tSetd2 and GFP were then confirmed using a fluorescent microscope and immunoblotting.

CRISPR Cas-9 mediated Setd2 knockout in C2C12 cells was performed by the Duke Functional Genomics Core. Three sgRNAs targeting Setd2 were designed using ChopChop and ordered as modified synthetic sgRNAs from Synthego28. 5 x 10e4 C2C12 cells were electroporated with 7.5pmol TrueCut Cas9 protein v2 (ThermoFisher Scientific) complexed with 22.5 pmol sgRNA using the Neon system (ThermoFisher Scientific) with the following settings: 1650 V, 10 ms, 3 pulses. Cells were recovered and expanded, followed by PCR sequencing and immunoblotting analysis to determine KO efficiencies. Based on this analysis, knockout clones were subsequently isolated from the pools generated with sgRNA #1 (GTCGGTCCGAAAGAGATCGA) and sgRNA #3 (GCATTCGCTTAATATCCCGG) by plating at limited dilution in 96 well plates. Clones were expanded for approximat ely 10-14 days before screening by PCR-sequencing to confirm out-of-frame insertions or deletions.

Samples were sent to Active Motif (Carlsbad, CA) for ChIP-Seq. Active Motif prepared chromatin, performed ChIP reactions, generated libraries, and sequenced the libraries. In brief, C2C12 cells were fixed in formaldehyde. Chromatin was isolated by adding lysis buffer, followed by disruption with a

Dounce homogenizer. Lysates were sonicated and the DNA sheared with Active Motif9s EpiShear probe sonicator (cat# 53051). Genomic DNA (Input) was prepared by treating aliquots of chromatin with RNase, proteinase K and heat for de-crosslinking, followed by SPRI beads clean up (Beckman Coulter) and quantitation by Clariostar (BMG Labtech). Extrapolation to the original chromatin volume allowed determination of the total chromatin yield.

An aliquot of chromatin, 30 ug chromatin (750 ng of Drosophila chromatin for spike-in for H3K36me329) was precleared with protein G agarose beads (Invitrogen). Genomic DNA regions of interest were isolated using 4ul of H3K36me3 (Active Motif cat# 61101, lot# 22264149) and 0.4ug of antibody against H2Av (Active Motif cat# 61686). Complexes were washed, eluted from the beads with SDS buffer, and subjected to RNase and proteinase K treatment. Crosslinks were reversed by incubation overnight at 65°C, and ChIP DNA was purified by phenol-chloroform extraction and ethanol precipitation. Quantitative PCR (qPCR) reactions were carried out in triplicate on specific genomic regions using SYBR Green Supermix (Bio-Rad). The resulting signals were normalized for primer efficiency by carrying out qPCR for each primer pair using Input DNA.

Illumina sequencing libraries (a custom type, using the same paired read adapter oligonucleotides30) were prepared from the ChIP and Input DNAs on an automated system (Apollo 342, Wafergen Biosystems/Takara). After a final PCR amplification step, the resulting DNA libraries were quantified and sequenced on Illumina9s NovaSeq 6000 (75 nt reads, single end).

The resulting sequence data were processed using the nf-core/chipseq pipeline31. Targets of key myogenic transcription factors were queried from TRRUST v232. deepTools233 were used for generating profile plots, while the Integrative Genomics Viewer was used for track visualization34. For the analysis of differential peaks, DESeq235 was used. Gene Set Enrichment Analysis was subsequently performed using

Cryopreserved C2C12 cells were sent to Active Motif to perform the ATAC-Seq assay. The cells were then thawed in a 37oC water bath, pelleted, washed with cold PBS, and tagmented as previously described37, with additional modifications38. Briefly, cell pellets were resuspended in lysis buffer, pelleted, and tagmented using the enzyme and buffer provided in the ATAC-Seq Kit (Active Motif). Tagmented DNA was then purified using the MinElute PCR purification kit (Qiagen), amplified with 10 cycles of PCR, and purified using Agencourt AMPure SPRI beads (Beckman Coulter). Resulting material was quantified using Qubit (Invitrogen) and TapeStation (Agilent), then sequenced with PE42 sequencing on the NovaSeq 6000 sequencer (Illumina).

The resulting sequencing data were processed using the nf-core/atacseq pipeline31. deepTools233 were used for generating profile plots and heatmaps. For the analysis of differential peaks, DESeq235 was used. Genomic Regions Enrichment of Annotations (GREAT) analysis was subsequently performed using

Independent sample T-tests were conducted using the ttest_ind function from the SciPy stats package40. Significance levels are denoted as follows: * for p < 0.05, ** for p < 0.01 and *** for p<0.001. Bar graphs depict the mean, with the error bars representing the standard deviation. During the preparation of this manuscript, the authors employed Bard and ChatGPT for language refinement to improve clarity and readability, as well as for assistance with specific aspects of code implementation and debugging. After using these tools, the authors thoroughly reviewed and revised the content as necessary. We take full responsibility for the final content of this publication.

Lombardini, J. B. & Sufrin, J. R. Chemotherapeu tic potential of methionine analogue inhibitors of tumor-derived methionine adenosyltransferases. Biochem. Pharmacol. 32, 4893495 (1983). Edmunds, J. W., Mahadevan, L. C. & Clayton, A. L. Dynamic histone H3 methylation during gene induction: HYPB/Setd2 mediates all H3K36 trimethylation. EMBO J. 27, 4063420 (2008). Bhattacharya, S. & Workman, J. L. Regulation of SETD2 stability is important for the fidelity of H3K36me3 deposition. Epigenetics and Chromatin 13, 1314 (2020).

McLean, C. Y. et al. GREAT improves functional interpretation of cis-regulatory regions. Nat. Biotechnol. 28, 4953501 (2010).

Sanderson, S. M., Gao, X., Dai, Z. & Locasale, J. W. Methionine metabolism in health and cancer: a nexus of diet and precision medicine. Nat. Rev. Cancer (2019) doi:10.1038/s41568-019-0187-8. 25. 26. 27. 28. 30. 31. 32. 33. 34. 35.

Kizer, K. O.et al. A Novel Domain in Set2 Mediates RNA Polymerase II Interaction and Couples

Labun, K. et al. CHOPCHOP v3: Expanding the CRISPR web toolbox beyond genome editing.

Nucleic Acids Res. 47, W1713W174 (2019). 29.

Egan, B. et al. An alternative approach to ChIP-Seq normalization enables detection of genomewide changes in histone H3 lysine 27 trimethylation upon EZH2 inhibition. PLoS One 11, 1320 (2016). chemistry. Nature 456, 53359 (2008).

Biotechnol. 38, 2763278 (2020).

Bentley, D. R. et al. Accurate whole human genome sequencing using reversible terminator Ewels, P. A. et al. The nf-core framework for community-curated bioinformatics pipelines. Nat. Han, H. et al. TRRUST v2: An expanded reference database of human and mouse transcriptional regulatory interactions. Nucleic Acids Res. 46, D3803D386 (2018).

Ramírez, F. et al. deepTools2: a next generation web server for deep-sequencing data analysis. Nucleic Acids Res. 44, W1603W165 (2016).

Robinson, J. T.et al. Integrative genomics viewer. Nat. Biotechnol. 29, 24326 (2011). Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNAseq data with DESeq2. Genome Biol. 15, 1321 (2014). 36. 37. chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat. Methods 10, 121331218 (2013). 38.

Corces, M. R. et al. An improved ATAC-seq protocol reduces background and enables interrogation of frozen tissues. Nat. Methods 14, 9593962 (2017). 39.

Tanigawa, Y., Dyer, E. S. & Bejerano, G. WhichT F is functionally important in your open chromatin data? PLoS Comput. Biol. 18, 1329 (2022).

Methods 17, 2613272 (2020).

Virtanen, P.et al. SciPy 1.0: fundamental algorithms for scientific computing in Python. Nat. (A) Schematic representation of the experimental design: C2C12 cells were transitioned from growth media (GM) with 200 µM methionine (MET) to differentiation media (DM) with methionine either stayed at 200 µM (CTL), restricted to 20 µM (MR) or completely depleted (MD, 0 µM). Imaging and assays were performed on D1, D3 and D5. (B) Representative images of C2C12 cells on Day 1 (D1), Day 3 (D3) and Day 5 (D5) under MET, MR, and MD conditions, displaying the disruption in elongated myotube formation under MR and MD conditions. (C) Quantification of differentiation progress using a custom-trained convolutional neural network to analyze cell images collected by phase contrast microscope. (D) Immunoblot analysis of myosin heavy chain protein (MyHC) expression during differentiation under different methionine conditions. (E) Schematic representation of the methionine cycle with key intermediates. (F-I) Abundance of methionine cycle intermediates under MR and MD relative to CTL. (J) Immunoblot analysis of common histone tri-methylation marks in response to MR and MD. (K) ChIP-Seq profile of H3K36me3 abundance across all genes during normal course of differentiation. TSS: Transcription Start Site, TES: Transcription End Site. (L, M) ChIP-Seq profile of H3K36me3 abundance across all genes in response to MR compared to CTL. (N) Representative images of C2C12 cells on Day 5 (D5) that were kept on differential media with a gradient of methionine concentration. (O) Quantification of differentiation progress on Day 5 (D5) cell images. (P) Immunoblot analysis of myosin heavy chain protein (MyHC) expression on Day 5 (D5) in cells that were kept on differentiation media with a varying methionine concentration. (Q) Immunoblot analysis of common histone tri-methylation marks on Day 5 (D5) in cells that were kept on differentiation media with a varying methionine concentration. (A) Experimental design depicting the normal 5-day differentiation period with methionine restriction (MR) or depletion (MD), followed by additional 5-day differentiation period with or without reintroduction of methionine at control concentration (200 µM). (B, C) Representative images of C2C12 cells and differentiation score showcasing differentiation recovery in MR and MD pre-treated cells post-methionine add-back. (D) Immunoblot analysis of common histone tri-methylation marks showcasing restoration of H3K36me3 levels upon methionine add-back. points across the differentiation window. (E) Schematic of the methionine cut-off experiment design, where MR was introduced at different time (F, G) Representative images of C2C12 cells and differentiation score at Day (D5) endpoint. (H) Time series plot of differentiation scores demonstrating that initiating MR at D2 has minimal impact on differentiation. (A) Schematic representation of SAM synthesis highlighting the SAM synthetase, MAT2A, and its inhibition by cycloleucine (cLEU). (B-E) Abundance of methionine cycle intermediates under cLEU, MR and MD relative to CTL. (F) Immunoblot analysis of common histone tri-methylation marks upon MAT2A inhibition, MR and MD. (G, H) Representative images of C2C12 cells and differentiation score at Day (D5) endpoint. (A) Immunoblot analysis of SETD2 levels during the five-day differentiation window. (B) Immunoblot analysis of SETD2 and truncated SETD2 (tSETD2) levels in WT, WT-GFP and WT-tSetd2 cells. (C) Immunoblot analysis of H36K36me3 in WT, WT-GFP and WT-tSetd2 cells under CTL and MR (D, E) Representative images of C2C12 cells and differentiation score at Day (D5) endpoint, showing improvements in differentiation progress in WT-tSetd2 cells. (F) Immunoblot analysis of myosin heavy chain protein (MyHC) expression at Day (D5) endpoint. (G) Immunoblot analysis of SETD2 levels in WT, Setd2 knockout cell lines. (H) Immunoblot analysis of H36K36me3 in WT and Setd2 knockout cell lines under 2X, CTL and MR (I) Immunoblot analysis of myosin heavy chain protein (MyHC) expression at Day (D5) endpoint in WT and Setd2 knockout cell lines under 2X, CTL and MR conditions. (J, K) Representative images of C2C12 cells and differentiation score at Day (D5) endpoint, showing disruption in differentiation in Setd2 knockout cell lines. (L, M) ChIP-Seq profile of H3K36me3 abundance across all genes in response to MR and Setd2 knockout compared to CTL. -10

TSS 10Kb -10 -10

TSS

TES

10Kb

B

WT-D1-CTL WT-D1-MR TSS

F [0 - 1.31]

C

WT-D5-CTL WT-D5-MR

H [0 - 1.10] A WT-D0 WT-D1-CTL

WT-D5-CTL

D [0 - 1.17] [0 - 1.17] Consensus peak cal ing and peak counting

Myog D1 MR É É É É É É É É É Peak 1 Peak 2 Peak 3 É

D1 CTL É É É É

Differential Peak Analysis Gene Set Enrichment Analysis FDRf0. 5 FDR>0. 5 L

Mef2c

Myod1

Tmem220 Myh3

Myh2

Myh4

Kif9

Setd2

Nradd

Ccdc12 Enrichment of up peaks in D5 CTL / D1 CTL

GO Terms with FDR < 0.05

Muscle diûerentiation related GO term

Enrichment of down peaks in D1 MR / D1 CT1 GO terms with FDR < 0.05 Muscle diûerentiation related GO term

Enrichment of down peaks in D5 MR / D5 CT1 GO terms with FDR < 0.05 Muscle diûerentiation related GO term

Top GO Terms cellular component assembly involved in morphogenesis muscle system process Differentiation-Related Genes (A) ChIP-Seq profile of H3K36me3 abundance across myogenic differentiation-related genes during normal course of differentiation. response to MR compared to CTL.

Myh genes (H) Setd2 different methionine conditions. (B, C) ChIP-Seq profile of H3K36me3 abundance across myogenic differentiation-related genes in (D-H) Gene-specific H3K36me3 profiles under CTL and MR conditions. (D) Myog (E) Mef2c (F) Myod1 (G) (I) Schematic representation of the workflow for differential ChIP peak analysis of H3K36me3 under (J) Gene Set Enrichment Analysis (GSEA) of genes displaying increased H3K36me3 levels in a D5 vs. D1 comparison at control methionine levels, with muscle differentiation related Gene Ontology (GO) terms dominate the top of the list. (K, L) GSEA of genes with diminished H3K36me3 peaks under MR: (K) D1 comparison (L) D5 comparison, with muscle differentiation-related GO terms dominate the top of the lists. bioRxiv preprint doi: https://doi.org/10.1101/2023.11.22.568331; this version posted

November 22, 2023. The copyright holder for this was peer review) is the who has granted bioRxiv a license to display the preprint in perpetuity. preprint is made available under aCC-BY-NC

A E

Consensus peak

cal ing and peak

counting D1 CTL

D1 MR Peak 1 Peak 2 Peak 3 É É É É É É É É É É É É É É Differential

Peak

Analysis Geno mic

Regions

Enrichment of Annotations

Analysis 4 .13 2 39 29.86 3 28.62 04 27. 6 89 23.79 6 2 . 1 1 65 20.5 19 43 8. 17 90 .25 17 0 6. 7 15 83

B C

D L T C 1 D / R M 1 D n i n w o d s k a e p n w o d s u s n

Enrichment of up peaks in

D1

CTL / D0

CTL Enrichment of down peaks in

D1

MR / D1

CTL Enrichment of down peaks in

D1

KO / D1

WT accessibility at differential related genes (A) Schematic representation of the workflow for differential ATAC-Seq peak analysis under different methionine conditions on WT and Setd2 knockout lines. (B) Genomic Regions Enrichment of Annotations (GREAT) analysis of ATAC-seq peaks that increased in intensity from Day 0 (D0) to Day 1 (D1) in WT cells. Muscle differentiation-related GO terms are (C) GREAT analysis of ATAC-seq peaks with diminished intensity comparing Day 1 under MR conditions to Day 1 under CTL conditions in WT cells. Muscle differentiation-related GO terms are predominantly (D) GREAT analysis of ATAC-seq peaks with diminished intensity between KO cells under CTL conditions and WT cells under CTL conditions on Day 1. Muscle differentiation-related GO terms are predominantly (E) ATAC-seq profiles and heatmaps of peaks that are diminished in response to MR compared to CTL in WT, and Setd2 knockout lines under CTL and MR conditions. Notably, applying MR to KO cells did not