COVID-19 is a spectrum of clinical symptoms in humans caused by infection with SARS-CoV-2, a recently emerged coronavirus that rapidly caused a pandemic. Coalescence of this virus with seasonal respiratory viruses, particularly influenza virus is a global health concern. To investigate this, transgenic mice expressing the human ACE2 receptor driven by the epithelial cell cytokeratin-18 gene promoter (K18-hACE2) were first infected with IAV followed by SARS-CoV-2. The host response and effect on virus biology was compared to K18-hACE2 mice infected with IAV or SARS-CoV2 only. Infection of mice with each individual virus resulted in a disease phenotype compared to control mice. Although SARS-CoV-2 RNA synthesis appeared significantly reduced in the sequentially infected mice, they exhibited more rapid weight loss, more severe lung damage and a prolongation of the innate response compared to singly infected or control mice. The sequential infection also exacerbated the extrapulmonary encephalitic manifestations associated with SARS-CoV-2 infection. Conversely, prior infection with a commercially available, multivalent liveattenuated influenza vaccine (Fluenz tetra) elicited the same reduction in SARS-CoV2 RNA synthesis albeit without the associated increase in disease severity. This suggests that the innate immune response stimulated by infection with IAV is responsible for the observed inhibition of SARS-CoV-2, however, infection with attenuated, apathogenic influenza vaccine does not result in an aberrant immune response and enhanced disease severity. Taken together, the data suggest that the concept of 8twinfection9 is deleterious and mitigation stesphould be instituted as part of a comprehensive public health response to the COVID-19 pandemic.

Coronaviruses were once described as the backwater of virology but the last two decades have seen the emergence of three major coronavirus threats (1). First, the emergence of severe acute respiratory syndrome coronavirus (SARS-CoV) in China in 2003. Second, Middle East respiratory syndrome coronavirus (2) in Saudi Arabia in 2012 and now SARS-CoV-2 originating in China in 2019. Whilst SARS-CoV was eradicated, both MERS-CoV and SARS-CoV-2 represent current ongoing health threats, and a greater understanding is required to develop robust interventions for future emergent coronaviruses. Coronaviruses share similar genome architectures and disease profiles and generally cause respiratory and gastrointestinal illnesses (1). However, some animal/avian coronaviruses can also affect other organ systems, causing, for example, demyelination and nephritis. The sheer scale of the COVID-19 outbreak has highlighted hitherto unexpected aspects of coronavirus infection in humans, including long term disease complications once the virus has been cleared. Infection of humans with SARS-CoV-2 results in a range of clinical courses, from asymptomatic to severe infection and subsequent death in not only at-risk individuals but also a small proportion of otherwise healthy individuals across all age groups. Severe infection in humans is typified by cytokine storms (3, 4), pneumonia and kidney failure. Examination of post-mortem tissue reveals a disconnect between viral replication and immune pathology (5). A range of other clinical signs also occur, including gastrointestinal symptoms such as vomiting, diarrhoea, abdominal pain and loss of appetite as well as loss of taste and smell (anosmia). A small number of patients have no overt respiratory symptoms at all. Typically, patients with severe COVID-19 present to hospital in the second week of illness. There is often a precipitous decline in respiratory function, without necessarily much in the way<aiorf hunger.= Once intubated, these patients have unique ventilatory characteristics, where they can be ventilated with relatively low inspired oxygen concentrations but need high positive end expiratory pressures.

Respiratory infections in humans and animals can also be synergistic in which an initial infection can exacerbate a secondary infection or vice versa. When multiple pathogens are in circulation at the same time this can lead to cooperative or competitive forms of pathogen-pathogen interactions (6). This was evident during the 1918 Spanish influenza A virus outbreak (IAV) where secondary bacterial pneumonia was thought to be a leading cause of death (7). Coinfections in other viral diseases, such as in patients with Ebola virus disease, have also been shown to contribute to the host response and outcome (8). Global influenza cases decreased due to the lockdowns implemented to contain SARS-CoV-2 spread (9-11), the lifting of these lockdowns in 2021 and 2022 has resulted in the return of seasonal influenza outbreaks (Weekly U.S. Influenza Surveillance Report, CDC, https://www.cdc.gov/flu/weekly/index.htm). With ongoing the SARS-CoV-2 waves caused by emerging variants of concern (VOCs) and a return to seasonal IAV outbreaks, coinfection with these respiratory pathogens is likely and this may exacerbate clinical disease and potentially outcome.

Previous work has shown coinfections are present in patients with severe coronavirus infection. For SARS-CoV co-circulation of human metapneumovirus was reported in an outbreak in Hong Kong. However, data suggested that outcomes were not different between patients with identified coinfections and those with SARS-CoV alone (12). For MERS-CoV, four cases of coinfection with IAV were described, and although no data was presented on the severity of symptoms this sample size would be too small to allow any meaningful conclusions (13). Post-mortem studies from patients with COVID-19 in Beijing (n=85) identified IAV in 10% of patients, influenza B virus in 5% and respiratory syncytial virus (RSV) in 3% of patients, but the absence of a carefully selected control arm prohibits conclusions to be drawn (14). Additionally, there have been several case reports of coinfections with IAV and SARS-CoV-2 in humans with severe outcomes (15-20) with one study from the UK reporting that patients with a coinfection exhibited a ~6 times higher risk of death(21). Whilst this suggests that coinfection is synergistic, this study also found that the risk of testing positive for SARS-CoV-2 was 68% lower among individuals who were positive for IAV infection, implying that the two viruses may competitively exclude each other(21). Whilst the analysis of post-mortem tissue is extremely informative in what may have led to severe coronavirus infection and death, the analysis of the disease in severe (but living cases) is naturally restricted by what tissues can be sampled (e.g. blood, nasopharyngeal swabs and bronchioalveolar lavages). Therefore, animal models of COVID-19 present critical tools to fill knowledge gaps for the disease in humans and for screening therapeutic or prophylactic interventions. Compatibility with a more extensive longitudinal tissue sampling strategy and a controlled nature of infection are key advantages of animal models (22). Studies in an experimental mouse model of SARS-CoV showed that coinfection of a respiratory bacterium exacerbated pneumonia (23). Different animal species can be infected with wild-type SARS-CoV-2 to serve as models of COVID-19 and these include mice, hamsters, ferrets, rhesus macaques and cynomolgus macaques. The K18-hACE2 transgenic (K18-hACE2) mouse, where hACE2 expression is driven by the epithelial cell cytokeratin-18 (K18) promoter, was developed to study SARS-CoV pathogenesis(24). This mouse is being used as a model that mirrors many features of severe COVID-19 in humans to develop understanding of the mechanistic basis of lung disease and to test pharmacological interventions(25, 26).

IAV and SARS-CoV-2 co- and sequential infections have already been studied in hamsters, with partly controversial results. In a first study, simultaneous or subsequent infection 24 hours apart, they led to more severe pneumonia (27). A similar study then found evidence that co-infection with SARS-CoV-2 leads to more widespread IAV infection in the lungs (28), while a third study described impaired IAV replication in lungs when hamsters were infected early and 10 days after SARS-CoV-2 inoculation, but no effect when IAV infection took place on day 21 post SARS-CoV-2 infection (29). With the liklihood of flu seasons concomitant with waves of SARS-CoV-2 infections there is an obvious public health concern about the possibility of enhanced morbidity and mortality in coinfected individuals. The aim of this work was to use an established pre-clinical model of COVID-19 to study the consequences of coinfection with SARSCoV-2 and IAV, defining the associated clinical, pathological and transcriptomic signatures.

To assess how coinfection with influenza virus affected SARS-CoV-2 infection, the established K18-hACE2 mouse model of SARS-CoV-2 was utilised (24). We used a clinical isolate of SARS-CoV-2 (strain hCoV19/England/Liverpool_REMRQ0001/2020)(30). Importantly, sequence of the virus stock demonstrated that this isolate did not contain deletions or mutations of the furin cleavage site in the S protein (31). A schematic of the experimental design is shown in Fig. 1A. Four groups of mice (n = 8 per group) were used. At day 0, two groups were inoculated intranasally with 102 PFU IAV (strain A/X31) and two groups with PBS. After three days, two groups were inoculated intranasally with 104 PFU of SARS-CoV-2. This generated four experimental groups: Control, IAV oSnlAy,RS-CoV-2 and IAV+ SARS-CoV-2 only (Fig. 1B). Control mice maintained their body wethi grohutghout. Mice infected with IAV displayed a typical pattern of weliogshst, reaching a nadir (mean 17% loss) at 7 dpi before starting recovery. SCAoRVS--2-infected animals started to lose weight at day 7 (4 dpi) and carried ogn wloesiignht up to day 10 (mean 15% loss). Mice infected with IAV then SACRoSV--2 had a significantly accelerated weight loss as compared with IAV-infected mice from dayis4;wtahs most severe at day 6 (mean 19%), followed by a recovery to day 8 (mean 14% bleofsosr)e losing weight again (mean 17% loss) (Fig. 2A). As well as accelewraetiegdht loss, IAV + SARS-CoV-2-infected mice exhibited more severe respiratory signs andgnaifisciantly more rapid mortality (assessed by a humane endpoint of 20% htwel oigss) as compared with mice infected with either virus alone (Fig. T2oBi)n.vestigate the effect of infecting mice with a non-pathogenic vaccine formulation of influenza, K18-ACE2 mice were dosed intranasally with Fluenz Tetra 3 days prior to SARS-CoV-2 infection (Fig. 1B). Mice that received Fluenz Tetra only, showed no significant deviation in weight loss in comparison to the PBS control (Fig 2A). Mice that received Fluenz Tetra immunisation followed by a SARS-CoV-2 infection initially had a slight reduction in weight at day 1 and day 2, however, between day 3 and day 8 resembled the PBS control mice, although at day 10 two coinfected mice had lost 13% and 9% of their body weight while two continued to gain weight (Fig. 2A). The animals showing weight loss did not exhibit severe respiratory signs associated with SARS-CoV-2 infection or coinfection. individual groups of mice.

In order to determine whether the coinfection of SARS-CoV-2 and IAV was cooperative or competitive total RNA was extracted from the lungs of the K18-hACE2 mice and viral loads were quantified using qRT-PCR. At day 6 (3 dpi), the SARS-CoV2 infected mice exhibited 10,000-fold higher levels of viral load than at day 10 (7 dpi) (mean 6 x 1012 vs 2.8 x 108 copies of N/µg of RNA) indicating that peak viral replication takes place before the onset of clinical signs at 4 dpi (Fig. 3A). At this time point the mice infected with SARS-CoV-2 alone displayed significantly higher levels of viral RNA than the mice with IAV and SARS-CoV-2 coinfection (mean 6 x 1012 vs ~2 x 109 copies of N/µg of RNA) (Fig. 3A). The mice preimmunised with Fluenz Tetra exhibited reduced levels of viral RNA compared to both SARS-CoV-2 singly and IAV coinfected mice, with 2/4 mice exhibiting no detectable viral RNA. However, by day 10 the SARSCoV-2 and IAV X31 coinfected and singly infected mice exhibited nearly identical levels of SARS-CoV-2 RNA (mean 2 x 108 vs 8.1 x 108 copies of N/µg of RNA) (Fig. 3A). Conversely, SARS-CoV-2 RNA levels were undetectable in 2/4 of the mice preimmunized with Fluenz Tetra, with only one animal displaying similar levels of viral RNA to the SARS-CoV-2 singly and IAV coinfected animals. The levels of infectious virus generally corresponded with the copies of N RNA, except at day 10, when there was no infectious virus in mice infected with SARS-CoV-2 alone whereas the level of infectious virus in coinfected mice was similar at both day 6 and day 10 (102 PFU/lung) (Fig. 3C). Conversely, at day 6, the mice infected with IAV alone showed similar levels of IAV RNA compared to the coinfected mice (mean 1.3 x 107 vs 1 x 107 copies of M/µg of RNA) and by day 10 both the singly infected mice and coinfected mice did not display any detectable IAV RNA, demonstrating similar levels of IAV clearance (Fig. 3D). Fluenz Tetra immunized mice displayed reduced levels of IAV viral RNA compared to IAV infected mice (mean 5 x 103), in line with the reduced replication expected of attenuated IAV. To investigate viral replication qPCR was employed to quantify viral subgenomic mRNA (sgRNA) transcripts. Unlike viral genomes, sgRNAs are not incorporated into virions, and can therefore be utilised to measure active virus infection. The amount of sgRNA in the SARS-CoV-2 infected mice was concomitant with the viral load, appearing to be 100-fold higher at day 6 (3dpi) than day 10 (7dpi) (mean 6.2 x 106 vs 5.4 x 104 copies of E sgRNA/µg of RNA) (Fig. 3B). Similarly, the amount of sgRNA was significantly lower in the coinfected mice compared to the SARS-CoV-2 singly infected mice (mean 6.2 x 106 vs 1.7 x 104 copies of E sgRNA/µg of RNA) however, by day 10 (7dpi) both coinfected and singly infected mice displayed similar levels of sgRNA (mean 5.4 x 104 vs 3.5 x 105 copies of E sgRNA/µg of RNA) (Fig. 3B). Fluenz tetra immunized mice exhibited further reduced levels of sgRNA at day 6, with only one mouse exhibiting detectable sgRNA, however by day 10 2/4 mice displayed detectable sgRNA.

Transgenic mice carrying the human ACE2 receptor under the control of the keratin 18 promoter (K18-hACE2) have been widely used as a COVID-19 model (25). As a basis for the assessment of the effect of IAV and SARS-CoV-2 in these mice, a histological examination of major organs/tissues was performed. This confirmed that the transgenic approach had not resulted in phenotypic changes. Comparative staining of wild type and K18-hACE2 mice for ACE2, using an antibody against human ACE2 that also cross-reacts with mouse ACE2, also confirmed that transgenesis had not altered the ACE2 expression pattern: in the lung, ACE2 was found to be expressed by respiratory epithelial cells and very rare type II pneumocytes (Supplementary Fig. S1A, B). Expression was also seen in the brain microvasculature where it has recently been shown to be expressed specifically by the pericytes (32)(Supplementary Fig. S2 A2, A3) and liver sinusoids and in renal tubular epithelial cells. The expression was not substantially affected by either viral infection (Supplementary Fig. S1C-F; Fig. S2 B, C).

At 6 days post IAV infection, the transgenic mice exhibited the pulmonary changes typically seen in wild type mice after IAV X31 infection at this time point. We observed epithelial cell degeneration and necrosis in several bronchioles which also contained debris in the lumen (Fig. 4B). There were occasional small focal peribronchial areas where alveoli also exhibited necrotic cells (Fig. 4B). IAV antigen was found in epithelial cells in bronchi and bronchioles, in type I and II pneumocytes in affected alveoli, and in few randomly distributed individual type II pneumocytes (data not shown). Vessels showed evidence of lymphocyte recruitment, vasculitis, and perivascular lymphocyte infiltration. Comparative assessment of the lungs in wild type mice at the same time point post infection confirmed that the genetic manipulation indeed had no effect on the response of mice to IAV infection (data not shown). At the comparative time point, SARS-CoV-2 single infection (day 6, 3 dpi) was associated with mild changes, represented by a mild increase in interstitial cellularity, evidence of type II pneumocyte activation (Fig. 4C, 5A), occasional desquamated alveolar macrophages/type II pneumocytes and single erythrocytes in alveolar lumina, and a multifocal, predominantly perivascular mononuclear infiltration with recruitment of leukocytes into vascular walls (vasculitis) (Fig. 4D). Infiltrating cells were predominantly macrophages, with T cells mainly around vessels and a low number of disseminated B cells (Fig. 5); macrophages and T cells were also found to emigrate from veins (Fig. 5D, E). Viral antigen was found in multifocal patches of individual to large groups of alveoli, randomly distributed throughout the parenchyma, within type I and type II pneumocytes (Fig. 5C), but not within bronchiolar epithelial cells (Fig. 5B). Double infection at this time point, i.e. 6 days after IAV infection and 3 days after SARS-CoV-2 infection, was associated with histological changes almost identical to those induced by IAV, although they appeared to be slightly more extensive (Fig. 4E, F). IAV antigen expression had a distribution and extent similar to that seen in single IAV infection at the same time point. It was observed in epithelial cells in bronchi and bronchioles, in type I and II pneumocytes in affected alveoli, and in few randomly distributed individual type II pneumocytes (Fig. 6B). SARS-CoV-2 expression was less intense than in SARS-CoV-2-only infected mice. Viral antigen was observed in random individual or small groups of alveoli (Fig. 6C), in type I and II pneumocytes (Fig. 6C inset).

Four days later, at the endpoint of the experiment, i.e. at 10 days after IAV infection and 7 days of SARS-CoV-2 infection, the histopathological features had changed. Single IAV infection had by then almost entirely resolved, however, the lungs exhibited changes consistent with a regenerative process, i.e. mild to moderate hyperplasia of the bronchiolar epithelium with adjacent multifocal respiratory epithelial metaplasia/type II pneumocyte hyperplasia, together with mild to moderate lymphocyte dominated perivascular infiltration (Fig. 6A). Interestingly, the hyperplastic epithelium was found to lack ACE2 expression (Supplementary Fig. S1E). At this stage, the effect of SARS-CoV-2 infection was more evident. Single infection had resulted in multifocal areas with distinct type II pneumocyte activation and syncytial cell formation (Fig. 7B), mononuclear infiltration and mild to moderate lymphocytedominated vasculitis and perivascular infiltration. There were also a few focal areas of mild desquamative pneumonia with intra-alveolar macrophages/type II pneumocytes, edema and fibrin deposition (Fig. 7C). Macrophages and T cells dominated in the infiltrates (Fig. 7D, E), whereas B cells were found disseminated in low numbers (Fig. 7F). The SARS-CoV-2 associated changes were also observed in the double infected mice (Fig. 8C-F) where they were generally more pronounced (Fig. 8B, C) and present alongside equally pronounced regenerative changes attributable to IAV infection (moderate hyperplasia of the bronchiolar epithelium with adjacent multifocal respiratory epithelial metaplasia/type II pneumocyte hyperplasia; Fig. 8A). Also, in this group of animals, macrophages were the dominant infiltrating cells. However, the number of T cells was comparatively low (Fig. 8D, E). B cells were generally rare, but occasionally formed small aggregates in proximity to areas of type II pneumocyte hyperplasia (Fig. 8F). Interestingly, the pattern of viral antigen expression had not changed with time; it was detected in type I and II pneumocytes of unaltered appearing alveoli (data not shown).

In two of the four single SARS-CoV-2 infected and three of the four double infected mice at the later time point (7 days post SARS-CoV-2 infection), we observed a mild or moderate non-suppurative meningoencephalitis, mainly affecting the midbrain and brainstem (Fig. 9). This was more severe in the double infected mice, where the perivascular infiltrates contained degenerate leukocytes and appeared to be associated with focal loss of integrity of the endothelial cell layer (Fig. 9B). - bronchiole; V - vessel. HE stain; immunohistology, hematoxylin counterstain. Bars represent 20 µm. few degenerate cells (right image; arrowheads). A3) Coronal section at the level of the hippocampus (HC), showing extensive SARS-CoV-2 antigen expression in the hypothalamus (HY) and bilateral patchy areas with positive neurons also in the cortex (CTX). A4) A higher magnification of a focal area with SARS-CoV-2 expression shows that infection is in the neurons (arrowheads). B) IAV and SARS-CoV-2 double infected K18-hACE2 transgenic mouse. B1, B2) The perivascular mononuclear infiltrate is slightly more intense than in the SARS-CoV-2 single infected mouse (B1: arrows), consistent with a moderate non-suppurative encephalitis. Among the perivascular infiltrate are several degenerate cells (B2: arrowheads). B3) Coronal section at the level of the corpus callosum (CC), showing extensive widespread bilateral SARS-CoV-2 antigen expression (HY: hypothalamus; CTX: cortex; LV: left ventricle). HE stain and immunohistology, hematoxylin counterstain. Bars represent 20 µm. The effect of Fluenz tetra immunisation on the lungs of the mice was assessed by histology and immunohistology. On day 6 after its application, lungs exhibited a mild multifocal increased interstitial cellularity, mild to moderate multifocal mononuclear (macrophages, lymphocytes) peribronchial and perivascular infiltration and mild vascular changes, i.e. mild endothelial cell activation as well as leukocyte rolling and emigration. There were very rare positive intact individual bronchiolar epithelial cells and type II pneumocytes (Supplementary Fig. 3A). SARS-CoV-2 coinfection (3 dpi) was associated with the same histological changes and IAV antigen expression, while SARS-CoV-2 antigen expression was not observed (Supplementary Fig. 3B). Examination of the nasal mucosa at this stage found IAV antigen expression restricted to a few, partly degenerate respiratory epithelial cells in one animal (Supplementary Fig. 3C) while SARS-CoV-2 antigen expression was found in individual and small patches of intact and occasionally degenerate respiratory epithelial cells (Supplementary Fig. 3C). The olfactory epithelium and brain were negative. At day 10 post Fluenz Tetra, histological changes in the lungs were restricted to a mildly increased interstitial cellularity and mild peribronchial and perivascular infiltration by lymphocytes and fewer plasma cells (Supplementary Figure 3D). At this stage, SARSCoV-2 coinfection (7 dpi) did not result in further changes in two of the four animals; neither showed SARS-CoV-2 NP expression in the lung, but there was evidence of infection, represented by a few individual respiratory epithelial cells in the nasal mucosa that were positive for viral antigen, without viral antigen expression in olfactory epithelium and/or brain. The remaining two animals showed changes consistent with SARS-CoV-2 infection, i.e. focal consolidated areas with several macrophages, activated type II cells and occasional syncytial cells, some lymphocytes and neutrophils, and a few degenerate cells (Supplementary Fig. 3E). SARS-CoV-2 NP expression was seen in a few individual macrophages within the focal lesions and in rare alveoli (type I and II epithelial cells) in one animal, and in several patches of alveoli in the second (Supplemental Fig. 3F). In the first animal, infected epithelial cells were not found in the nasal mucosa, but there were individual neurons and a few larger patches of positive neurons and neuronal processes in the frontal cortex and brain stem. In the second animal, the brain was negative, but there were a few SARS-CoV2 antigen positive respiratory epithelial cells in the nasal mucosa.

The transcriptional profile of lung samples can provide a window on the host response to infection for a respiratory pathogen. Therefore, lung samples were taken at day 6 and day 10 post IAV or Fluenz Tetra infection from all groups of mice (Fig. 1B). Total RNA was purified from cells and both host and viral mRNA (and genomic RNA in the case of SARS-CoV-2) were sequenced on the NovaSeq illumina platform.

Transcripts were counted against the Mus musculus transcriptome using Salmon(33). Gene counts were inferred through tximport and normalised using the edgeR package before identifying differentially expressed genes using the transcription profile from mock infected mice as the control profile. A total of 22101 genes were identified, where the number of transcripts significantly changing in abundance are presented in Table 1. The top 50 differentially expressed genes form clusters (through the pheatmap hclust parameter) based on the experimental groups, where at day 6 IAV and coinfection belong to the same cluster. By day 10 each experimental group can be distinguished by the transcript expression and are more similar to mock than day 6 mice (Fig 10A). Principle component analysis (PCA) revealed separation between IAV and SARS-CoV-2 groups and overlap between coinfection and IAV infection groups (Fig. 10B). Overlapping signatures are likely representing the non-specific anti-viral response. Contrast matrices were made between mice that were coinfected versus mice that were mock infected and mice that were singly infected (Table 1). When comparing coinfected mice to IAV only at day 6, there were no significant transcripts identified to have changed in abundance, however, by day 10 there were significant differences (Table 1 & Fig. 11A). The coinfected mice had significant changes in comparison to SARS-CoV-2 only infected mice at both day 6 and day 10, where more differences were observed at day 6 (Table 1 & Fig. 11C-D). occurs via breakdown of the BBB following high levels of viremia (45, 47). BBB integrity is also reduced by proinflammatory cytokines such as IL-6, IL-1³ and IF N-´ which disrupt the tight junctions maintained by brain microvascular endothelial cells (reviewed in (48)). While the IAV X31 strain used herein did not result in brain infection, it is possible that the increased cytokine response present in coinfected animals further compromised the BBB integrity and allowed increased leukocyte recruitment. As brain invasion was only apparent in 1/4 of the Fluenz Tetra immunized mice post SARSCoV-2 infection, it can be postulated that the innate immune response raised by attenuated IAV was sufficient to reduce SARS-CoV-2 infectivity, without resulting in a pathogenic immune response associated with increased neuroinvasion. The increased pathogenicity associated with coinfection can therefore be the consequence of a pathological overstimulation of the innate immune response.

No animal model can predict with absolute certainty the consequences of coinfection in humans. However, the data presented here may have critical implications for development of successful pre-emptive interventions for SARS-CoV2. Fortunately, public health interventions aimed at delaying the transmission of SARS-CoV-2 should also provide a consequent reduction in transmission of influenza virus if they are effectively implemented. Moreover, some but not all experimental therapeutics being studied for SARS-CoV-2 have also been demonstrated to exhibit activity against influenza virus. As for other viruses for which successful antiviral interventions have been developed, the SARS-CoV-2 polymerase has emerged as a strong initial target for small molecule inhibitors. Importantly, drugs such as remdesivir and favipiravir that are in various stages of development and clinical evaluation for SARS-CoV-2 have a direct or metabolite-driven in vitro activity against influenza virus (49, 50), with favipiravir also approved for influenza in Japan. Other examples of dual activity against these viruses are evident with other small molecule antivirals such as nitazoxanide (51-53) and niclosamide (54, 55), which may present opportunities and/or a basis for prioritisation of candidates for clinical evaluation if necessary exposures can be achieved (56, 57). Such antiviral interventions have potential application in treatment of early infection as well as the prophylactic setting. Chemoprevention is a particularly attractive approach when we move into winter months, and selection of the right candidates for evaluation may provide a benefit for both viruses individually and in coinfections. It should be noted that many of the advanced technologies (e.g. broadly neutralising monoclonal antibodies) that are being rapidly accelerated through development have explicit specificities that provide high potency, but this is likely to preclude activity against viruses other than those against which they are directed. The work presented here shows that experimental setting would be an effective pre-clinical platform with which to test therapeutic approaches to dealing with coinfection which is pertinent with the return of seasonal flu outbreaks concomitant with reoccurring global outbreaks of SARS-CoV-2 VOCs.

This work was funded by the US Food and Drug Administration Grant, Characterization of severe coronavirus infection in humans and model systems for medical countermeasure development and evaluation, to JAH, and by the Biotechnology and Biological Sciences Research Council (BBSRC) grants BB/R00904X/1 and BB/R018863/1 to JPS. RPR was supported by a PhD studentship from the MRC Discovery Medicine North (DiMeN) Doctoral Training Partnership (MR/N013840/1).

LT is supported by the Wellcome Trust (grant number 205228/Z/16/Z) and the National Institute for Health Research Health Protection Research Unit (NIHR HPRU) in Emerging and Zoonotic Infections (NIHR200907) at University of Liverpool in partnership with Public Health England (PHE), in collaboration with Liverpool School of Tropical Medicine and the University of Oxford. LT is based at University of Liverpool. The views expressed are those of the author(s) and not necessarily those of the NHS, the NIHR, the Department of Health or Public Health England.

Influenza virus A/HKx31 (X31, H3N2) was propagated in the allantoic cavity of 9-dayold embryonated chicken eggs at 35oC for 72 h. Titres were determined by an influenza plaque assay using MDCK cells.

Vero E6 cells (C1008; African green monkey kidney cells) were obtained from Public Health England and maintained in Dulbecco9s minimal essential medium (DMEM) containing 10% foetal bovine serum (FBS) and 0.05 mg/mL gentamycin at 37°C with 5% CO2.

UK strain of SARS-CoV-2 (hCoV-2/human/Liverpool/REMRQ0001/2020), which was cultured from a nasopharyngeal swab from a patient, was passaged a further 4 times in Vero E6 cells (30). The fourth passage of virus was cultured MOI of 0.001 in Vero E6 cells with DMEM containing 4% FBS and 0.05 mg/mL gentamycin at 37°C with 5% CO2 and was harvested 48 h post inoculation. Virus stocks were stored at −80°C. The intracellular viral genome sequence and the titre of virus in the supernatant were determined. Direct RNA sequencing was performed as describe previously (31) and an inhouse script was used to check for deletions in the mapped reads. The Illumina reads were mapped to the England/2/2020 genome using HISAT and the consensus genome was called using an in-house script based on the dominant nucleotide at each location on the genome. The sequence has been submitted to Genbank, accession number MW041156. Fluenz tetra (AstraZeneca) is a commercially available quadrivalent live vaccine composed of attenuated A/Victoria/2570/2019 (H1N1) pdm09, A/Cambodia/e0826360/2020 (H3N2), B/Washington/02/2019 and B/Phuket/3073/2013.

The patient from which the virus sample was obtained gave informed consent and was recruited under the International Severe Acute Respiratory and emerging Infection Consortium (ISARIC) Clinical Characterisation Protocol CCP (https://isaric.net/ccp), reviewed and approved by the national research ethics service, Oxford (13/SC/0149). Samples from clinical specimens were processed at containment level 3 at the University of Liverpool.

Biosafety. All work was performed in accordance with risk assessments and standard operating procedures approved by the University of Liverpool Biohazards SubCommittee and by the UK Health and Safety Executive. Work with SARS-CoV-2 was performed at containment level 3 by personnel equipped with respirator airstream units with filtered air supply.

Animal work was approved by the local University of Liverpool Animal Welfare and Ethical Review Body and performed under UK Home Office Project Licence PP4715265. Mice carrying the human ACE2 gene under the control of the keratin 18 promoter (K18-hACE2; formally B6.Cg-Tg(K18-ACE2)2Prlmn/J) were purchased from Jackson Laboratories. Mice were maintained under SPF barrier conditions in individually ventilated cages.

Animals were randomly assigned into multiple cohorts. For IAV infection, mice were anaesthetized lightly with KETASET i.m. and inoculated intra-nasally with 102 PFU IAV X31 in 50 µl sterile PBS. For SARS-CoV-2 infection, mice were anaesthetized lightly with isoflurane and inoculated intra-nasally with 50 µl containing 104 PFU SARSCoV-2 in PBS. For Fluenz Tetra immunization, mice were anesthatised with isoflurane and intranasally inoculated with 50 μl of vaccine formulation. Each 50ul of Fluenza Tetra contains around 2x106±4 of A/Victoria/2570/2019 (H1N1)pdm09, A/Cambodia/e0826360/2020 (H3N2), B/Washington/02/2019 and B/Phuket/3073/2013. Mice were sacrificed at variable time points after infection by an overdose of pentabarbitone. Tissues were removed immediately for downstream processing.

For SARS-CoV-2 and IAV coinfection studies, the left lung, kidneys, liver and brain as well as the head were fixed in 10% neutral buffered formalin for 24-48 h and routinely paraffin wax embedded (prior to embedding, the heads were sawn in the midline and gently decalcified in RDF (Biosystems) for twice 5 days, at room temperature (RT) and on a shaker). Consecutive sections (3-5 µm) were either stained with hematoxylin and eosin (HE) or used for immunohistology (IH). IH was performed to detect viral antigens lungs were routinely paraffin wax embedded and stained as described above.

The upper lobes of the right lung were dissected and homogenised in 1ml of TRIzol reagent (Thermofisher) using a Bead Ruptor 24 (Omni International) at 2 meters per second for 30 sec. The homogenates were clarified by centrifugation at 12,000xg for 5 min before full RNA extraction was carried out according to manufarc9sture instructions. RNA was quantified and quality assessed using a Nanodrop (Thermofisher) before a total of 1 μg was DNase treated using the TURBO DNA-free™ Kit (Thermofisher) as per manufacturer9s instructions. qRT-PCR for viral load Viral loads were quantified using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-COV-2 the nCOV_N1 primer/probe mix from the SARS-CoV-2 (2019-nCoV) CDC qPCR Probe Assay (IDT) were utilised while the standard curve was generated via 10-fold serial dilution of the 2019-nCoV_N_Positive Control (IDT) from 106 to 0.1 copies/reaction. The E sgRNA primers and probe have been previously described (https://www.nature.com/articles/s41586-020-2196-x) and were utilised at 400nM and 200nM respectively. Murine 18S primers and probe sequences ere utilsied at 400nM and 200nM respectively. The IAV primers and probe sequences are published as part of the CDC IAV detection kit (20403211). The IAV reverse genetics plasmid encoding the NS segment was diluted 10-fold from 106 to 0.1 copies/reaction to serve as a standard curve. The thermal cycling conditions for all qRT-PCR reactions were as follows: 1 cycle of 45°C for 15 min and 1 cycle of 95°C followed by 40 cycles of 95°C for 15 sec and 60°C for 1 minute. The 18s standard was generated by the amplification of a fragment of the murine 18S cDNA using the primers F: ACCTGGTTGATCCTGCCAGGTAGC and R: GCATGCCAGAGTCTCGTTCG. Similarly, the E sgRNA standard was generated by PCR using the qPCR primers. cDNA was generated using the SuperScript IV reverse transcriptase kit (Thermofisher) and PCR carried out using Q5® High-Fidelity 2X Master Mix (New England Biolabs) as per manufacturer9s instructions. Both PCRrodpucts were purified using the QIAquick PCR Purification Kit (Qiagen) and serially diluted 10-fold from 1010 to 104 copies/reaction to form the standard curve.

Following the manufactures protocols, total RNA from lung tissue were used as input material in to the QIAseq FastSelect –rRNA HMR (Qiagen) protocol to remove cytoplasmic and mitochondrial rRNA with a fragmentation time of 7 or 15 minutes. Subsequently the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs) was used to generate the RNA libraries, followed by 11 cycles of amplification and purification using AMPure XP beads. Each library was quantified using Qubit and the size distribution assessed using the Agilent 2100 Bioanalyser and the final libraries were pooled in equimolar ratios. The raw fastq files (2 x 150 bp) generated by an Illumina® NovaSeq 6000 (Illumina®, San Diego, USA) were trimmed to remove Illumina adapter sequences using Cutadapt v1.2. (Cut adapt reference). The option <−O 3= was set, so the that 39 end of any hreicahdsmwatched the adapter sequence with greater than 3 bp was trimmed off. The reads were further trimmed to remove low quality bases, using Sickle v1.200 (https://github.com/najoshi/sickle) with a (61) minimum window quality score of 20. After trimming, reads shorter than 10 bp were removed.

Trimmed paired end sequencing reads were inputted into salmon (v1.5.2) using the -l A –validateMappings –SeqBias –gcBias parameters. Quant files generated with salmon were imported into RStudio (4.1.1) using tximport to infer gene expression (62). The edgeR package (3.34.1) was used to normalise sequencing libraries and identify differentially expressed genes, defined as at least a 2-fold difference from the mock infected group and a false discovery rate (FDR) less than 0.05 51. Principle component Analysis (PCA), volcano plots, heatmaps and Venn diagrams were produced in R studio using the following packages: edgeR, ggplot2 (3.3.5) and pheatmap (1.0.12). Differential gene expression data was used for gene ontology enrichment analysis of biological process terms in each group using the compareCluster function with enrichGO in the ClusterProfiler package (4.0.5) programme in R (63). Code used to analyse data is available at https://github.com/Hiscox-lab/k18-hACE2-coinfection-transcriptomics. Sequencing reads are available under BioProject ID: PRJNA886870 on Short Read Archive (SRA).

Statistical analysis. Data were analysed using the Prism package (version 5.04 Graphpad Software). P values were set at 95% confidence interval. A repeatedmeasures two-way ANOVA (Bonferroni post-test) was used for time-courses of weight loss; two-way ANOVA (Bonferroni post-test) was used for other time-courses; log-rank (Mantel-Cox) test was used for survival curves. All differences not specifically stated to be significant were not significant (p > 0.05). For all figures, *p < 0.05, **p <0.01, ***p < 0.001. 10. 11. 12. 13. 14. 15. 16. 17. 35. 54.

A. Jurgeit et al., Niclosamide is a proton carrier and targets acidic endosomes with broad antiviral effects. PLoS Pathog 8, e1002976 (2012).

S. Jeon et al., Identification of Antiviral Drug Candidates against SARS-CoV-2 from FDA-Approved Drugs. Antimicrob Agents Chemother 64, (2020).

U. Arshad et al., Prioritization of Anti-SARS-Cov-2 Drug Repurposing Opportunities Based on Plasma and Target Site Concentrations Derived from their Established Human Pharmacokinetics. Clin Pharmacol Ther 108, 775-790 (2020).

R. K. Rajoli et al., Dose prediction for repurposing nitazoxanide in SARS-CoV-2 treatment or chemoprophylaxis. medRxiv, (2020).

A. S. Schmid, T. Hemmerle, F. Pretto, A. Kipar, D. Neri, Antibody-based targeted delivery of interleukin-4 synergizes with dexamethasone for the reduction of inflammation in arthritis. Rheumatology (Oxford). 57, 748-755 (2018).

D. J. Hughes et al., Chemokine binding protein M3 of murine gammaherpesvirus 68 modulates the host response to infection in a natural host. PLoS Pathog 7, e1001321 (2011).

F. Calabrese et al., Herpes virus infection is associated with vascular remodeling and pulmonary hypertension in idiopathic pulmonary fibrosis. PLoS One 8, e55715 (2013).

M. Martin, Cutadapt removes adapter sequences from high-throughput sequencing reads. 2011 17, 3 (2011).

C. Soneson, M. I. Love, M. D. Robinson, Differential analyses for RNA-seq: transcriptlevel estimates improve gene-level inferences. F1000Res 4, 1521 (2015).

T. Wu et al., clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. The Innovation 2, 100141 (2021). at 10 dpi. ACE2 expression lacks in hyperplastic bronchiolar (B) epithelial cells (arrow) and hyperplastic type II pneumocytes (*). There are a few individual positive type II pneumocytes (arrowheads). V – vessel. HE stain and immunhistology, hematoxylin counterstain. Bars represent 20 µm.

E2. There are several patches of alveoli with SARS-CoV-2 antigen positive type I and II pneumocytes (arrows). Immunohistology; bar represents 250 µm.

S5: The top 10 cellular component terms reported from clusterProfiler to assess gene enrichment following differential gene expression analysis.

S6: The top 10 molecular function terms reported from clusterProfiler to assess gene enrichment following differential gene expression analysis. decreasing in abundance when comparing the Fluenz tetra and SARS-CoV-2 infected group and SARS-CoV-2 only infected group (following comparison to mock infected). Clusters identified in <up= represent a higher abundanceS AinRS-CoV-2 infected only, whereas <down= represents a higher abundance in Fluenzateatrnd SAR S-CoV-2.