April Common ALS/FTD risk variants in UNC13A exacerbate its cryptic splicing and loss upon TDP-43 mislocalization Authors: Anna-Leigh Brown 4 Oscar G. Wilkins 12 4 Matthew J. Keuss 4 Sarah E. Hill 8 Matteo Zanovello 4 Weaverly Colleen Lee 4 Flora C.Y. Lee 12 4 Laura Masino 12 Yue A. Qi 8 Sam Bryce-Smith 4 Alexander Bampton 10 9 Ariana Gatt 10 9 Hemali Phatnani 0 NYGC ALS Consortium Giampietro Schiavo 4 7 Elizabeth M.C. Fisher 4 Towfique Raj 1 11 5 7 Maria Secrier 2 Tammaryn Lashley 10 9 Jernej Ule 12 3 4 Emanuele Buratti 6 Jack Humphrey 1 11 5 7 Michael E. Ward michael.ward4@nih.gov 8 Pietro Fratta p.fratta@ucl.ac.uk 4 Affiliations: Center for Genomics of Neurodegenerative Disease, New York Genome Center (NYGC) , New York, NY , USA Department of Genetics and Genomic Sciences & Icahn Institute for Data Science and Genomic Technology, Icahn School of Medicine at Mount Sinai , New York, NY , USA Department of Genetics, Evolution and Environment, UCL Genetics Institute, University College London , UK Department of Molecular Biology and Nanobiotechnology, National Institute of Chemistry , Ljubljana , Slovenia Department of Neuromuscular Diseases, UCL Queen Square Institute of Neurology , London , UK Estelle and Daniel Maggin Department of Neurology, Icahn School of Medicine at Mount Sinai , New York, NY , USA Molecular Pathology Lab, International Centre for Genetic Engineering and Biotechnology (ICGEB) , Trieste , Italy Nash Family Department of Neuroscience & Friedman Brain Institute, Icahn School of Medicine at Mount Sinai , New York, NY , USA National Institute of Neurological Disorders and Stroke, NIH , Bethesda, MD , USA Queen Square Brain Bank, UCL Queen Square Institute of Neurology, University College London , UK Queen Square Department of Neurodegenerative Disease, UCL Queen Square Institute of Neurology, University College London , UK Ronald M. Loeb Center for Alzheimer’s Disease, Icahn School of Medicine at Mount Sinai , New York, NY , USA The Francis Crick Institute , London , UK 2021 4 2021 1124 1161

7The NYGC ALS Consortium is detailed in supplemental acknowledgments.

 † These authors contributed equally to this work -

39 Variants within the UNC13A gene have long been known to increase risk of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), two related neurodegenerative diseases defined by mislocalization of the RNA-binding protein TDP-43. Here, we show that TDP-43 depletion induces robust inclusion of a cryptic exon (CE) within UNC13A, a critical synaptic gene, resulting in nonsense-mediated decay and protein loss. Strikingly, two common polymorphisms strongly associated with ALS/FTD risk directly alter TDP-43 binding within the CE or downstream intron, increasing CE inclusion in cultured cells and in patient brains. Our findings, which are the first to demonstrate a genetic link specifically between loss of TDP-43 nuclear function and disease, reveal both the mechanism by which UNC13A variants exacerbate the effects of decreased nuclear TDP-43 function, and provide a promising therapeutic target for TDP-43 proteinopathies.

 One-Sentence Summary:

Shared ALS/FTD risk variants increase the sensitivity of a cryptic exon in the synaptic gene UNC13A to TDP-43 depletion.

 Main Text: Introduction

Amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) are devastating adultonset neurodegenerative disorders with shared genetic causes and common pathological aggregates (1–3). Genome-wide association studies (GWASs) have repeatedly demonstrated a shared risk locus between ALS and FTD within the crucial synaptic gene UNC13A, although the mechanism underlying this association has remained elusive ( 4 ).

ALS and FTD are pathologically defined by cytoplasmic aggregation and nuclear depletion of TAR DNA-binding protein 43 (TDP-43) in the vast majority (>97%) of ALS cases and in 45% of FTD cases (FTLD-TDP) ( 5 ). TDP-43, an RNA-binding protein (RBP), primarily resides in the nucleus and plays key regulatory roles in RNA metabolism, including acting as a splicing repressor. Upon TDP-43 nuclear depletion – an early pathological feature in ALS/FTLD-TDP – non-conserved intronic sequences are de-repressed and erroneously included in mature RNAs. These events are referred to as cryptic exons (CEs) and can lead to premature stop-codons/polyadenylation and transcript degradation ( 6, 7 ). Recently, TDP-43 loss was found to induce a CE in the Stathmin 2 (STMN2) transcript, which can serve as a functional readout for TDP-43 proteinopathy, as it appears selectively in affected patient tissue and its level correlates with TDP-43 phosphorylation ( 8-10 ).

In this study, we report a novel CE in UNC13A which promotes nonsense-mediated decay, and is present at remarkably high levels in patient neurons. Strikingly, we find that ALS/FTD risk-associated SNPs within UNC13A promote increased inclusion of this CE. We thus elucidate the molecular mechanism behind one of the top GWAS hits for ALS/FTD, and provide a promising new therapeutic target for TDP-43 proteinopathies. 81 82 To discover novel CEs induced by TDP-43 depletion, we performed RNA-seq on human induced pluripotent stem cell (iPSC)-derived cortical-like i3Neurons in which we reduced TDP-43 expression through CRISPR inhibition (CRISPRi) (10–13). We identified 179 CEs, including several previously reported, such as AGRN, PFKP and STMN2 (6–9) (Fig. 1A; data S1) (Fig. 1B; data S2). Interestingly, we observed robust mis-splicing in two members of the UNC13 synaptic protein family, UNC13A and UNC13B (Fig. 1C-F). Notably, UNC13A polymorphisms modify both disease risk and progression in ALS and FTLD-TDP (4, 14–21) pointing towards a potential functional relationship between TDP-43, UNC13A, and disease risk.

Inspection of the UNC13A gene revealed a previously unreported CE after TDP-43 knockdown (KD), with both a shorter and longer form, between exons 20 and 21 (Fig. 1C), and increased IR between exons 31 and 32 (fig. S1B). One ALS/FTLD-TDP risk SNP – rs12973192 (17) – lies 16 bp inside the CE (henceforth referred to as the CE SNP). Another SNP – rs12608932 ( 4 ) – is located 534 bp downstream of the donor splice site of the CE inside the same intron (henceforth referred to as the intronic SNP) (Fig. 1D). While there are five polymorphisms associated with ALS risk along UNC13A, they are all in high linkage disequilibrium (LD) in European populations with both the CE and intronic SNPs, and are present in 35% of individuals (Fig. 1G)(17). The close proximity of the disease-associated SNPs to the UNC13A CE suggests that the SNPs may influence UNC13A splicing. In UNC13B, TDP-43 KD led to the inclusion of an annotated frame-shift-inducing exon between exons 10 and 11, henceforth referred to as the UNC13B frameshift exon (fsE), and increased intron retention (IR) between exon 21 and 22 (Fig. 1E,F; fig. S1A).

In support of a direct role for TDP-43 regulation of UNC13A and UNC13B, we found multiple TDP-43 binding peaks both downstream and within the body of the UNC13A CE (Fig. 1D) and IR (fig. S1B) ( 22 ), and UNC13A CE inclusion negatively correlated with TARDBP RNA levels (rho = -0.43, p=0.077, Fig. 1H). Additionally, TDP-43 binding peaks were present near both splice events in UNC13B (Fig. 1F; fig. S1A) ( 22 ). We also detected these splicing changes in RNA-seq from TDP-43 depleted SH-SY5Y and SK-N-DZ neuronal lines, as well as in publicly available iPSC-derived motor neurons (MNs) ( 8 ) and SK-N-DZ datasets ( 23 )(Fig. 1I-L; fig. S1C), and validated them by PCR in SH-SY5Y and SK-N-DZ cell lines (fig. S1D,E). UNC13A and UNC13B RNA and protein are downregulated by TDP-43 knockdown Next, we examined whether incorrect splicing of UNC13A and UNC13B affected transcript levels in neurons and neuron-like cells. TDP-43 KD significantly reduced UNC13A RNA abundance in the three cell types with the highest levels of cryptic splicing (FDR < 0.1; Fig. 2A, Fig. 1I). Likewise, UNC13B RNA was significantly downregulated in four datasets (FDR < 0.1) (Fig. 2B). We confirmed these results by qPCR in SH-SY5Y and SK-N-DZ cell lines (fig. S2A). The number of ribosome footprints aligning to UNC13A and UNC13B was reduced after TDP-43 KD (Fig. 2C; fig. S2B, data S3). TDP-43 KD also decreased expression of UNC13A and UNC13B at the protein level, as assessed by quantitative proteomics with liquid chromatography tandem-mass spectrometry and western blot (Fig. 2D,E). These data suggest that the missplicing in UNC13A and UNC13B after TDP-43 KD reduces their transcript and protein abundance in neurons. 124 125 126 127 128 129 130 131

The UNC13A CE contains a premature termination codon (PTC) and is thus predicted to promote nonsense-mediated decay (NMD). Cycloheximide (CHX) treatment, which stalls translation and impairs NMD, increased CE inclusion in UNC13A after TDP-43 KD. Conversely, CHX did not alter levels of the aberrant STMN2 transcript, which is not predicted to undergo NMD (Fig. 2F). Taken together, our data suggests that TDP-43 is critical for maintaining normal expression of the presynaptic proteins UNC13A and UNC13B by ensuring their correct premRNA splicing.

UNC13A cryptic exon is highly expressed in TDP-43-depleted patient neurons

To explore whether the UNC13A CE could be detected in patient tissues affected by TDP-43 pathology, we first analysed RNA-seq from neuronal nuclei sorted from frontal cortices of ALS/FTLD patients ( 24 ). We compared levels of UNC13A CE to levels of a CE in STMN2 known to be regulated by TDP-43. Both STMN2 and UNC13A CEs were exclusive to TDP-43depleted nuclei, and, strikingly, in some cases the UNC13A CE percent spliced in (PSI) reached 100% (Fig. 3A). This suggests that in patients there will be a significant loss of UNC13A expression within the subpopulation of neurons with TDP-43 pathology.

Next, we quantified UNC13A CE inclusion in bulk RNA-seq from the NYGC ALS Consortium, a dataset containing 1,349 brain and spinal cord tissues from a total of 377 ALS, FTLD, and control individuals. The UNC13A CE was detected exclusively in FTLD-TDP and ALS-TDP cases (89% and 38% respectively), with no detection in ALS-non-TDP (SOD1 and FUS mutations), FTLD-non-TDP (FTLD-TAU and FTLD-FUS), or control cases. The lower detection rate in ALS versus FTLD is likely due to the lower expression of UNC13A in the spinal cord (fig. S3A). Thus, pathological UNC13A CEs occur in vivo and are specific to neurodegenerative disease subtypes in which mislocalization and nuclear depletion of TDP-43 occurs.

UNC13A CE expression mirrored the known tissue distribution of TDP-43 aggregation and nuclear clearance ( 25 ): it was specific to ALS-TDP spinal cord and motor cortex, as well as FTLD-TDP frontal and temporal cortices, but absent from the cerebellum in disease and control states (Fig. 3B). Despite the CE PSI being diluted by both the presence of unaffected cells and NMD in bulk RNA-seq, we were still able to detect CE above 20% in some samples. Furthermore, although, unlike the STMN2 CE, the UNC13A CE induces NMD, it was detected at similar levels to STMN2 CE in cortical regions, whilst STMN2 CE was more abundant in the spinal cord (Fig. 3C). We next investigated whether UNC13A CEs could be visualised by in situ hybridisation (ISH) in FTLD patient brains. Using a probe targeting the UNC13A CE on frozen frontal cortex tissue, we detected staining significantly above background in 4 out of 5 tested FTLD-TDP cases, but in none of the FTLD-Tau (n=3) or control (n=5) cases (Fig. 3D; fig. S3B).

To assess if UNC13A CE levels in bulk tissue was related to the level of TDP-43 proteinopathy, we used STMN2 CE PSI as a proxy, as it correlates with the burden of phosphorylated TDP-43 in patient samples ( 10 ). As expected, across the NYGC ALS Consortium samples we observed a significant positive correlation between the level of STMN2 CE PSI and UNC13A CE PSI (rho = 0.55, p = 3.0e-4) (Fig. 3E). Combined, our analysis reveals a strong relationship between TDP-43 pathology and UNC13A CE levels, supporting a model for direct regulation of UNC13A mRNA splicing by TDP-43 in patients. 166 rs12973192(G) and rs12608932(C) combine to promote cryptic splicing To test whether the ALS/FTD UNC13A risk SNPs promote cryptic splicing, which could explain their link to disease, we assessed UNC13A CE levels across different genotypes, and found significantly increased levels in cases homozygous for CE rs12973192(G) and intronic rs12608932(C) SNPs (fig. S4A-B). To ensure that this was not simply due to more severe TDP43 pathology in these samples, we normalised by the level of STMN2 cryptic splicing, and again found a significantly increased level of the UNC13A CE in cases with homozygous risk variants (Wilcoxon test, p < 0.001) (Fig. 4A; fig. S4C,D). Next, we performed targeted RNA-seq on UNC13A CE from temporal cortices of ten heterozygous risk allele cases and four controls. We detected significant biases towards reads containing the risk allele (p < 0.05, single-tailed binomial test) in six samples, with a seventh sample approaching significance (Fig. 4B), suggesting that the two ALS/FTLD-linked variants promote cryptic splicing in vivo.

To specifically examine whether the CE or the intronic SNP of UNC13A promote CE splicing, we generated four variants of minigenes containing UNC13A exon 20, intron 20, and exon 21, featuring both risk alleles (2R), both non-risk alleles (2H), the risk allele within the CE (rs12973192) (RE), or the risk allele in the intron (rs12608932) (RI) (Fig. 4C). We then expressed these minigenes in SH-SY5Y cells with doxycycline-inducible TDP-43 knockdown. We found that both the CE SNP and, to a lesser extent, intronic SNP independently promoted CE inclusion, with the greatest overall levels detected for the 2R minigene (Fig. 4D,E).

To explore how these two SNPs might act to enhance CE splicing, we analyzed a dataset of in vitro RNA heptamer/RBP binding enrichments, and examined the effect of the SNPs on relative RBP enrichment ( 26 ). Strikingly, when investigating which RBPs were most impacted in their RNA binding enrichment by the CE-risk SNP, TDP-43 had the third largest decrease of any RBP, with only two non-human RBPs showing a larger decrease (Fig. 4F,G; fig. S4E,F). To test whether the CE SNP directly inhibited in vitro TDP-43 binding, we performed isothermal titration calorimetry using recombinant TDP-43 and 14-nt RNAs. As predicted, we observed an increased Kd for RNA containing the CE risk SNP (Fig. 4H; fig. S4G,H; Data S4). Together these data predict that the UNC13A CE SNP may directly inhibit TDP-43 binding.

To directly study the impact of the SNPs on TDP-43 binding to UNC13A pre-mRNA, we performed TDP-43 iCLIP with cells expressing either the 2R or 2H minigene. We observed a striking enrichment of crosslinks within the ~800nt UG-rich region containing both SNPs in intron 20 (Fig. 4I). When comparing the 2R with the 2H minigene, the peaks with the largest fractional changes were in close proximity of each SNP; similarly, we detected a 21% decrease in total TDP-43 crosslinks centred around the CE SNP and a 73% increase upstream of the intronic SNP (Fig. 4I, J, fig. S4I; 50 nucleotide windows). These data demonstrate that these two disease-risk SNPs distort the pattern of TDP-43/RNA interactions, decreasing TDP-43 binding near the CE donor splice site, thus exacerbating UNC13A CE inclusion upon nuclear TDP-43 depletion.

 Discussion

Our results support a model wherein TDP-43 nuclear depletion and the intronic and CE SNPs in UNC13A synergistically reduce expression of UNC13A, a gene that is critical for normal neuronal function. In this model, when nuclear TDP-43 levels are normal in healthy individuals, TDP-43 efficiently binds to UNC13A pre-mRNA and prevents CE splicing, regardless of 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238

UNC13A SNPs. Conversely, severe nuclear depletion of TDP-43 in end-stage disease induces CE inclusion in all cases. However, the common intronic and CE SNPs in UNC13A alter TDP-43 binding to UNC13A pre-mRNA and may make UNC13A CE more sensitive to partial TDP-43 loss that occurs early in degenerating neurons, explaining their associated risk effect. Strikingly, we found that both risk alleles for these SNPs independently and additively promoted cryptic splicing in vitro. Intriguingly, when the two variants are not co-inherited, as seen in East Asian individuals with ALS, an attenuated effect is observed ( 20 ). A similar phenomenon wherein SNP pairs both contribute to risk has been widely studied at the APOE locus in Alzheimer’s disease ( 27 ).

UNC13-family proteins are highly conserved across metazoans and are essential for calcium-triggered synaptic vesicle release ( 28 ). In mice, double knockout of UNC13A and UNC13B inhibits both excitatory and inhibitory synaptic transmission in hippocampal neurons and greatly impairs transmission at neuromuscular junctions ( 29, 30 ). In TDP-43-negative neuronal nuclei derived from patients, the UNC13A CE is present in up to 100% of transcripts, suggesting that expression of functional UNC13A is greatly reduced, which could impact normal synaptic transmission.

TDP-43 loss induces hundreds of splicing changes, a number of which have also been detected in patient brains. However, it has remained unclear whether these events – even those that occur in crucial neuronal genes – contribute to disease pathogenesis. That genetic variation influencing the UNC13A CE inclusion can lead to changes in ALS/FTD susceptibility and progression strongly supports UNC13A downregulation to be one of the critical consequences of TDP-43 loss of function. Excitingly, UNC13A provides a generalizable therapeutic target for 97% of ALS and approximately half of FTD cases. These findings are also of interest to other neurodegenerative diseases, such as Alzheimer’s disease, Parkinson’s disease and chronic traumatic encephalopathy, in which TDP-43 depletion is also observed in a significant fraction of cases. 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576

 Acknowledgments:

We thank Frédéric Allain for the His-tagged TDP-43 plasmid, Cristiana Stuani for guidance on TDP-43 purification, and Martina Hallegger for guidance on TDP-43 iCLIP.

 Funding:

UK Medical Research Council [MR/M008606/1 and MR/S006508/1] (PF) UK Motor Neurone Disease Association (PF) Rosetrees Trust (PF,AG) UCLH NIHR Biomedical Research Centre (PF) 4 Year Wellcome Trust Studentship (OGW) European Union’s Horizon 2020 research and innovation programme (835300RNPdynamics) (JU) Cancer Research UK (FC001002) (JU) UK Medical Research Council (FC001002) (JU) Wellcome Trust (FC001002) (JU) Collaborative Center for X-linked Dystonia-Parkinsonism (WCL, EMCF) Intramural Research Program of the National Institutes of Neurological Disorders and Stroke, NIH, Bethesda, MD (MEW,SEH) Chan Zuckerberg Initiative (MEW) The Robert Packard Center for ALS Research (MEW) E.B. is funded by AriSLA PathensTDP project (EB) Wolfson Foundation (AB) Brightfocus Foundation postdoctoral research fellowship (SEH) Wellcome Trust Investigator Award (107116/Z/15/Z) (GS) UK Dementia Research Institute Foundation award (UKDRI-1005) (GS) Alzheimer’s Research UK senior fellowship (TL) Alzheimers Society (AG)

UKRI Future Leaders Fellowship (MR/T042184/1) (MS)

 Author contributions:

Conceptualization: ALB,OGW,MJK,SEH,JH,MEW,PF Data curation: ALB,OGW,MZ,SBS Formal analysis: ALB,OGW,MJK,MZ,SBS,AB Funding acquisition: PF,MEW,EB Investigation: ALB,OGW,MJK,SEH,MZ,FCYL,LM,YAQ,SBS,AB,WCL,AG Methodology: ALB,OGW,MJK,SEH,JH,MEW,PF Project administration: PF,MEW 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615

Resources: HP,TL,EB

Software: ALB,OGW,MZ,SBS,JH Supervision: PF,MEW,JH,JU,MS,TR,TL,EMCF,GS Visualization: ALB,OGW,MJK,WCL Writing – original draft: ALB,OGW,MJK,MEW,PF Writing – review & editing: SEH,WCL,EB,JU,JH

 Competing interests:

ALB, OGW, MJK, SEH, MEW and PF declare competing financial interest. A patent application related to this work has been filed.

 Data and materials availability:

Analysis code and data to reproduce figures available: https://github.com/frattalab/unc13a_cryptic_splicing/ RNA-Seq Data for i3Neurons, SH-SY5Y and SK-N-DZa are available through the European Nucleotide Archive (ENA) under accession PRJEB42763.

Public data was obtained from Gene Expression Omnibus (GEO): iPSC MNs (Klim et al., 2019)GSE121569, SK-N-DZb-GSE97262, and FACS-sorted frontal cortex neuronal nucleiGSE126543.

Riboseq: E-MTAB-10235.

Targeted RNA seq: E-MTAB-10237

Minigene iCLIP: E-MTAB-10297 NYGC ALS Consortium RNA-seq: RNA-Seq data generated through the NYGC ALS Consortium in this study can be accessed via the NCBI’s GEO database (GEO GSE137810, GSE124439, GSE116622, and GSE153960). All RNA-Seq data generated by the NYGC ALS Consortium are made immediately available to all members of the Consortium and with other consortia with whom we have a reciprocal sharing arrangement. To request immediate access to new and ongoing data generated by the NYGC ALS Consortium and for samples provided through the Target ALS Postmortem Core, complete a genetic data request form at ALSData@nygenome.org.

NYGC ALS Consortium Whole Genome Seq: to be released later with companion manuscript.

 Supplementary Materials Materials and Methods Figs. S1 to S4

Table S1 References (31–57) 623 624 625 626 627

Fig. 1. TDP-43 depletion in neurons leads to altered splicing in synaptic genes UNC13A and UNC13B. (A) Differential splicing and (B) expression in control (N=4) and CRISPRi TDP-43 3 depleted (N=3) iPSC-derived cortical-like i Neurons. Each point denotes a splice junction (A) or 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 gene (B). (C) Sashimi plots showing cryptic exon (CE) inclusion between exons 20 and 21 of UNC13A upon TDP-43 knockdown (KD). (D,F) Schematics showing intron retention (IR, lower schematic, orange), TDP-43 binding region ( 22 )(green), and two ALS/FTLD associated SNPs (red). (E) Sashimi plot of UNC13B showing inclusion of the frameshifting exon (fsE) upon TDP43 KD. (G) LocusZoom plot of the UNC13A locus in the latest ALS GWAS. Lead SNP rs12973192 plotted as purple diamond, other SNPs coloured by linkage disequilibrium with rs12973192 in European individuals from 1000 Genomes. (H) Correlation between relative TARDBP RNA and UNC13A CE PSI across five TDP-43 knockdown datasets (I,K) PSI of TDP43 regulated splicing in UNC13A and UNC13B across neuronal datasets. (J,L) Intron retention ratio of TDP-43 regulated retained introns in UNC13A and UNC13B across neuronal datasets.

A 150% *

Control

TDP-43 KD * **** iPSC MN

SH-SY5Y i3Neurons SK-N-DZa SK-N-DZb

Ribosome Profiling

No cryptic

With cryptic

STMN2 TARDBP UNC13A

UNC13B -2.5

Fig. 2. UNC13A and UNC13B are downregulated after TDP-43 knockdown due to the production of NMD-sensitive transcripts. Relative gene expression levels for UNC13A (A) and UNC13B (B) after TDP-43 knockdown across neuronal cell lines. Normalized RNA counts are shown as relative to control mean. Numbers show log2 fold change calculated by DESeq2. Significance shown as adjusted p-values from DESeq2. (C) Ribosome profiling of TDP-43 knockdown in i3Neurons shows reduction in ribosome occupancy of STMN2, UNC13A and E

F 238 150 50 50 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678

UNC13B transcripts. (D) Mass spectrometry-based proteomic analysis shows reduction in 3 protein abundance of UNC13A, UNC13B and TDP-43 upon TDP-43 knockdown in i Neurons. Numbers refer to log2 fold change of unique peptide fragments, P-values from Wilcoxon test. (E) Western blot analysis of protein lysates from untreated and TDP-43 knockdown SH-SY5Y cells show a significant reduction in UNC13A and UNC13B proteins levels after TDP-43 depletion. Graphs represent the means ± S.E., N=3, One sample t-test, (F) Transcript expression upon CHX treatment suggests UNC13A but not STMN2, are sensitive to nonsense-mediated decay. HNRNPL (heterogeneous nuclear ribonucleoprotein L) is a positive control. Significance levels reported as * (p<0.05) ** (p<0.01) *** (p<0.001) **** (p <0.0001). known markers of TDP-43 loss of function. (A) UNC13A and STMN2 CE expression in ALS/FTLD patient frontal cortex neuronal nuclei from ( 24 ) sorted according to the expression of nuclear TDP-43. (B) UNC13A CE expression in bulk RNA-seq from NYGC ALS Consortium normalized by library size across disease and tissue samples. ALS cases stratified by mutation status, FTLD cases stratified by pathological subtype. (C) CE expression throughout ALS/FTLD-TDP cases across tissue (D) BaseScope detection of UNC13A CE (red foci) in FTLD-TDP but not control or FTLD-Tau frontal cortex samples. (E) Correlation in ALS/FTLD688

TDP cortex between UNC13A and STMN2 CE PSI in patients with at least 30 spliced reads 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708

Fig. 4. UNC13A ALS/FTD risk variants enhance UNC13A CE splicing in patients and in vitro by altering TDP-43 pre-mRNA binding. (A) Ratio UNC13A / STMN2 CE PSI, split by genotype for UNC13A risk alleles. (B) Unique cDNAs from targeted RNA-seq in ten CE SNP heterozygous FTLD-TDP patients. p-values from single-tailed binomial tests. FTD1, 5, and 7 are C9orf72 hexanucleotide repeat carriers (C) Illustration of UNC13A minigenes containing exon 20, intron 20, and exon 21 with both risk SNPs (2R), both healthy SNPs (2H), or risk SNP in CE (RE) or intron (RI). (D) Representative image of RT-PCR products from UNC13A minigenes in SH-SY5Y ± TDP-43 KD. (E) Quantification of (D) plotted as means ± S.E. N=3, One-way ANOVA analysis; (F) Average change in E-value (measure of binding enrichment) across proteins for heptamers containing risk/healthy CE SNP allele; red - TDP-43. (G) Each CE SNP heptamer’s TDP-43 E-value. (H) Binding affinities between TDP-43 and 14-nt RNA containing the healthy or risk sequence measured by ITC; 4 replicates. (I) TDP-43 iCLIP of 2R and 2H minigenes: top - average crosslink density; bottom - average density change 2R - 2H (rolling window = 20 nt, units = crosslinks per 1,000). Cartoon - predicted TDP-43 binding footprints (UGNNUG motif). (J) Fractional changes at iCLIP peaks for 2R versus 2H minigene (mean and 75% confidence interval shown). Peaks that are within 50nt of each SNP are highlighted. *** (p<0.001) ** (p<0.01) * (p<0.05).

Supplementary materials

Materials and Methods Other Supplementary Materials for this manuscript include the following: 727 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779

Materials and Methods:

Human iPSC culture

All policies of the NIH Intramural research program were followed for the procurement and use of induced pluripotent stem cells (iPSCs). The iPSCs used in this study were from the WTC11 line, derived from a healthy thirty-year old male, and obtained from the Coriell cell repository. All culture procedures were conducted as previously ( 11 ). In short, iPSCs were grown on tissue culture dishes coated with hESC-qualified matrigel (Corning, REF 354277). They were maintained in Essential 8 Medium (E8; Thermo Fisher Scientific, Cat. No. A1517001) supplemented with 10 μM ROCK inhibitor (RI; Y-27632; Selleckchem, Cat. No. S1049) in a 37°C, 5% CO2 incubator. Media was replaced every 1-2 days as needed. Cells were passaged with accutase (Life Technologies, Cat. No. A1110501), 5-10 minutes treatment at 37°C. Accutase was removed and cells were washed with PBS before re-plating. Following dissociation, cells were plated in E8 media supplemented with 10 μM RI to promote survival. RI was removed once cells grew into colonies of 5-10 cells.

The following cell lines/DNA samples were obtained from the NIGMS Human Genetic Cell Repository at the Coriell Institute for Medical Research: GM25256

 TDP-43 knockdown in human iPSCs

The human iPSCs used in this study were previously engineered ( 11, 13 ) to express mouse Neurogenin-2 (NGN2) under a doxycycline-inducible promoter integrated at the AAVS1 safe harbor, as well as an enzymatically dead Cas9 (+/- CAG-dCas9-BFP-KRAB) integrated at a safe harbor at the CLYBL promoter ( 12 ).

To achieve knockdown, sgRNAs targeting either TARDBP/TDP-43 or a non-targeting control guide were delivered to iPSCs by lenti-viral transduction. To make the virus, Lenti-X Human Embryonic Kidney (HEK) cells were transfected with the sgRNA plasmids using Lipofectamine 3000 (Life Technologies, Cat. No. L3000150), then cultured for 2-3 days in the following media: DMEM, high glucose GlutaMAX Supplement media (Life Technologies, Cat. No. 10566024) with 10% FBS (Sigma, Cat. No. TMS-013-B), supplemented with viral boost reagent (ALSTEM, Cat. No. VB100). Virus was then concentrated from the media 1:10 in PBS using Lenti-X concentrator (Takara Bio, Cat. No. 631231), aliquoted and stored at -80°C for future use.

The sgRNAs were cloned into either pU6-sgRNA EF1Alpha-puro-T2A-BFP vector (gift from Jonathan Weissman; Addgene #60955) ( 12, 31 ) or a modified version containing a human U6 promoter, a blasticidin (Bsd) resistance gene, and eGFP. sgRNA sequences were as follows: non-targeting control: GTCCACCCTTATCTAGGCTA and TARDBP: GGGAAGTCAGCCGTGAGACC.

Virus was delivered to iPSCs in suspension following an accutase split. Cells were plated and cultured overnight. The following morning, cells were washed with PBS and media was changed to E8 or E8+RI depending on cell density. Two days post lentiviral delivery, cells were selected overnight with either puromycin (10 μg/ml) or blasticidin (100 μg/ml). iPSCs were then expanded 1-2 days before initiating neuronal differentiation. Knockdown efficiency was tested at iPSC and neuronal stages using immunofluorescence, QT-PCR and observed in RNA-seq data. iPSC-derived i3Neuron differentiation and culture

To initiate neuronal differentiation, 20-25 million iPSCs per 15 cm plate were individualized using accutase on day 0 and re-plated onto matrigel-coated tissue culture dishes in N2 differentiation media containing: knockout DMEM/F12 media (Life Technologies Corporation, Cat. No. 12660012) with N2 supplement (Life Technologies Corporation, Cat. No. 17502048), 1x GlutaMAX (Thermofisher Scientific, Cat. No. 35050061), 1x MEM nonessential amino acids (NEAA) (Thermofisher Scientific, Cat. No. 11140050), 10 μM ROCK inhibitor (Y-27632; Selleckchem, Cat. No. S1049) and 2 μg/mL doxycycline (Clontech, Cat. No. 631311). Media was changed daily during this stage.

On day 3 pre-neuron cells were replated onto dishes coated with freshly made poly-L-ornithine (PLO; 0.1 mg/ml; Sigma, Cat. No. P3655-10MG), either 96-well plates (50,000 per well), 6-well dishes (2 million per well), or 15 cm dishes (45 million per plate), in i3Neuron Culture Media: BrainPhys media (STEMCELL Technologies, Cat. No. 05790) supplemented with 1x B27 Plus Supplement (ThermoFisher Scientific, Cat. No. A3582801), 10 ng/mL BDNF (PeproTech, Cat. No. 450-02), 10 ng/mL NT-3 (PeproTech, Cat. No. 450-03), 1 μg/mL mouse laminin (Sigma, Cat. No. L2020-1MG), and 2 ug/mL doxycycline (Clontech, Cat. No. 631311). i3Neurons were then fed 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 three times a week by half media changes. i3Neuron were then harvested on day 17 post addition of doxycycline or 14 days after re-plating.

 Generation of Stable TDP-43 knockdown cell line

SH-SY5Y and SK-N-DZ cells were transduced with SmartVector lentivirus (V3IHSHEG_6494503) containing a doxycycline-inducible shRNA cassette for TDP-43. Transduced cells were selected with puromycin (1 μg/mL) for one week.

 Depletion of TDP-43 from immortalised human cell lines

SH-SY5Y cells for RT-qPCR validations and western blots were grown in DMEM/F12 containing Glutamax (Thermo) supplemented with 10% FBS (Thermo). For induction of shRNA against TDP-43 cells were treated with 5 μg/mL Doxycyline Hyclate (Sigma D9891). After 3 days media was replaced with Neurobasal (Thermo) supplemented with B27 (Thermo) to induce differentiation. After a further 7 days, cells were harvested for protein or RNA. SH-SY5Y and SK-N-DZ cells for RNA-seq experiments were treated with siRNA, as previously described ( 23 ).

RNA-sequencing, differential gene expression and splicing analysis

For RNA-seq experiments of i3Neurons, the i3Neurons were grown on 96-well dishes. To harvest on day 17, media was completely removed, and wells were treated with tri-reagent (100 μL per well) (Zymo research corporation, Cat. No. R2050-1-200). Then 5 wells were pooled together for each biological replicate: control (n=3); TDP-43 knockdown (n=4). To isolate RNA, we used a Direct-zol RNA miniprep kit (Zymo Research Corporation, Cat. No. R2052), following manufacturer’s instructions including the optional DNAse step. Note: one control replicate did not pass RNA quality controls and so was not submitted for sequencing. Total RNA was then enriched for polyA and sequenced 2x75 bp on a HiSeq 2500 machine.

Samples were quality trimmed using Fastp with the parameter “qualified_quality_phred: 10”, and aligned to the GRCh38 genome build using STAR (v2.7.0f) ( 32 ) with gene models from GENCODE v31 ( 33 ). Gene expression was quantified using FeatureCounts ( 34 ) using gene models from GENCODE v31. Any gene which did not have an expression of at least 0.5 counts per million (CPM) in more than 2 samples was removed. For differential gene expression analysis, all samples were run in the same manner using the standard DESeq2 ( 35 ) workflow without additional covariates, except for the Klim MNs dataset, where we included the day of differentiation. DESeq2’s median of ratios, which controls for both sequencing depth and RNA composition, was used to normalize gene counts. Differential expression was defined at a Benjamini-Hochberg false discovery rate < 0.1. Our alignment pipeline is implemented in Snakemake version 5.5.4 ( 36 ) and available at: https://github.com/frattalab/rna_seq_snakemake.

Differential splicing was performed using MAJIQ (v2.1) ( 37 ) using the GRCh38 reference genome. A threshold of 0.1 ΔPSI was used for calling the probability of significant change between groups. The results of the deltaPSI module were then parsed using custom R scripts to obtain a PSI and probability of change for each junction. Cryptic splicing was defined as junctions with PSI < 0.05 in control samples, ΔPSI > 0.1, and the junction was unannotated in GENCODE v31. Our splicing pipeline is implemented in Snakemake version 5.5.4 and available at: https://github.com/frattalab/splicing.

Counts for specific junctions were tallied by parsing the STAR splice junction output tables using bedtools ( 38 ). Splice junction parsing pipeline is implemented in Snakemake version 5.5.4 and available at: https://github.com/frattalab/bedops_parse_star_junctions

Percent spliced in (PSI) = using coordinates from Table S1.

Intron retention was assessed using IRFinder ( 39 ) with gene models from GENCODE v31.

Analysis of published iCLIP data

Cross-linked read files from TDP-43 iCLIP experiments in SH-SY5Y and human neuronal stem cells ( 22 ) were processed using iCount v2.0.1.dev implemented in Snakemake version 5.5.4, available at https://github.com/frattalab/pipeline_iclip . Sites of cross-linked reads from all replicates were merged into a single file using iCount group command. Significant positions of cross-link read density with respect to the same gene (GENCODE v34 annotations) were then identified using the iCount peaks command with default parameters. The pipeline 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889

Western Blot

SH-SY5Y cells were lysed directly in the sample loading buffer (Thermo NP0008). Lysates were heated at 95°C for 5 min with 100 mM DTT. If required lysates were passed through a QIAshredder (Qiagen) to shear DNA. Lysates were resolved on 4-12% Bis-Tris Gels (Thermo) or homemade 6% Bis-Tris gels and transferred to 0.45 μm PVDF (Millipore) membranes. After blocking with 5% milk, blots were probed with antibodies [Rb anti-UNC13A (Synaptic Systems 126 103); Rb anti-UNC13B (abcam ab97924); Rat anti-Tubulin (abcam ab6161), Mouse antiTDP-43 (abcam ab104223)] for 2 hours at room temperature. After washing, blots were probed with HRP conjugated secondary antibodies and developed with Chemiluminescent substrate (Thermo) on a ChemiDoc Imaging System (Bio-Rad). Band intensity was measured with ImageJ (NIH).

 RT-qPCR

RNA was extracted from SH-SY5Y and SK-N-DZ cells with a RNeasy kit (Qiagen) using the manufacturer's protocol including the on column DNA digestion step. RNA concentrations were measured by Nanodrop and 1 μg of RNA was used for reverse transcription. First strand cDNA synthesis was performed with SSIV (Thermo 18090050) or RevertAid (Thermo K1622) using random hexamer primers and following the manufacturer's protocol including all optional steps. Gene expression analysis was performed by qPCR using Taqman Multiplex Universal Master Mix (Thermo 4461882) and TaqMan assays (UNC13A-Fam Hs00392638_m1, UNC13B-Fam Hs01066405_m1, TDP-43-Vic Hs00606522_m1, GAPDH-Jun asay 4485713) on a QuantStudio 5 Real-Time PCR system (Applied Biosystems) and quantified using the ΔΔCt method ( 40 ).

Nonsense-mediated decay (NMD) inhibition

Ten days post induction of shRNA against TDP-43 with 1 µg/ml doxycyline hyclate (Sigma D9891-1G), SH-SY5Y cells were treated either with 100 μM cycloheximide (CHX) or DMSO for 6 hours ( 41 ) before harvesting the RNA through RNeasy Minikit (Qiagen). Reverse transcription was performed using RevertAid cDNA synthesis kit (Thermo), and transcript levels were quantified by qPCR (QuantStudio 5 Real-Time PCR system, Applied Biosystems) using the ΔΔCt method and GAPDH as reference ( 40 ). Since it proved to undergo NMD ( 42 ), hNRNPL NMD transcript was used as a positive control.

Quantification of TDP-43, UNC13A, and UNC13B using quantitative proteomics i3Neurons were harvested from 6-well plates on day 17 post initiation of differentiation. Two wells were pooled for each biological replicate, n=6 for each control and TDP-43 knockdown neurons. To harvest, wells were washed with PBS, and then SP3 protein extraction was performed to extract intercellular proteins. Briefly, we harvested and lysed using a very stringent buffer (50 mM HEPES, 50 mM NaCl, 5 mM EDTA 1% SDS, 1% Triton X-100, 1% NP-40, 1% Tween 20, 1% deoxycholate and 1% glycerol) supplemental with cOmplete protease inhibitor cocktail at 1 tablet/10 ml ratio. The cell lysate was reduced by 10 mM dithiothreitol (30 min, 60°C) and alkylated using 20 mM iodoacetamide (30min, dark, room temperature). The denatured proteins were captured by hydrophilic magnetic beads, and tryptic on-beads digestion was conducted for 16 hours at 37°C. We injected 1 μg resulting peptides to a nano liquid chromatography (LC) for separation, and subsequently those tryptic peptides were analyzed on an Orbitrap Eclipse mass spectrometer (MS) coupled with a FAIMS interface using data-dependent acquisition (DDA) and data-independent acquisition (DIA). The peptides were separated on a 120 minute LC gradient with 2-35% solvent B (0.1% FA, 5% DSMO in acetonitrile), and FAIMS’s compensation voltages were set to -50, -65 and -80. For DDA, we used MS1 resolution at 12000 and cycle time was selected for 3 seconds, MS2 fragments were acquired by linear ion trap. For DIA, we used 8 m/z isolation windows (400-1000 m/z range), cycle time was set to 3 seconds, and MS2 resolution was set to 30000. The DDA and DIA MS raw files were searched against Uniprot-Human-Proteome_UP000005640 database with 1% FDR using Proteome Discoverer (v2.4) and Spectronaut (v14.1), respectively. The raw intensity of quantified peptides was normalized by total peptides intensity identified in the same sample. The DDA quantified TDP-43- and UNC13A-derived unique and sharing peptides were parsed out and used for protein quantification. Specifically, we visualized and quantified the unique peptides of UNC13A using their MS/MS fragment ion intensity acquired by DIA.

 Ribosome profiling

For ribosome profiling experiments, i3Neurons were grown on 15 cm plates, one plate per biological replicate for control (n=4) and TDP-43 knockdown (n=4) neurons. On day 17, i3Neuron Culture Medium was replaced 90 minutes prior to harvesting the neurons to boost translation. Then the medium was removed, cells were 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 washed with cold PBS, PBS was removed and 900 μL of cold lysis buffer (20 mM Tris pH 7.4, 150 mM NaCl, 5mM MgCl2, 1 mM DTT freshly made, 100 ug/mL Cycloheximide, 1% TX100; 25 U/ml Turbo DNase I) was added to each 15 cm plate. Lysed cells were scraped and pipetted into microcentrifuge tubes on ice. Cells were then passed through a 26-gauge needle 10 times, and then centrifuged twice at 19,000xg 4°C, for 10 minutes, each time moving the supernatant to a fresh tube. Tubes containing supernatant were flash frozen in liquid nitrogen and stored at -80°C until processing.

Ribosome footprints from 3x TDP-43 knockdown and 3x control samples were generated and purified as described, using a sucrose cushion (McGlincy and Ingolia, 2017) and a customised library preparation method based on revised iCLIP ( 43 ). No rRNA depletion step was performed, and libraries were sequenced on an Illumina Hi-Seq 4000 machine (SR100). Reads were demultiplexed and adaptor/quality trimmed using Ultraplex (https://github.com/ulelab/ultraplex), then aligned with Bowtie2 against a reference file containing abundant ncRNAs that are common contaminants of ribosome profiling, including rRNAs ( 44 ). Reads that did not pre-map were then aligned against the human genome with STAR ( 32 ) and the resulting BAM files were deduplicated with UMI-tools ( 45 ). Multi-mapping reads were discarded and reads 28-30nt in length were selected for analysis. FeatureCounts ( 34 ) was used to count footprints aligning to annotated coding sequences, and DESEQ2 ( 35 ) was used for differential expression analysis, using default parameters in both cases. Periodicity analysis was performed using a custom R script, using transcriptome-aligned bam files. Raw data has been uploaded to E-MTAB-10235.

Genome-wide association study data

Harmonised summary statistics for the latest ALS GWAS (17) were downloaded from the NHGRI-EBI GWAS Catalog ( 46 ) (accession GCST005647). Locus plots were created using LocusZoom ( 47 ), using linkage disequilibrium values from the 1000 Genomes European superpopulation ( 48 ).

NYGC ALS Consortium RNA-seq cohort

Our analysis contains 377 patients with 1349 neurological tissue samples from the NYGC ALS dataset, including non-neurological disease controls, FTLD, ALS, FTD with ALS (ALS-FTLD), or ALS with suspected Alzheimer’s disease (ALS-AD). Patients with FTD were classified according to a pathologist’s diagnosis of FTD with TDP-43 inclusions (FTLD-TDP), or those with FUS or Tau aggregates. ALS samples were divided into the following subcategories using the available Consortium metadata: ALS with or without reported SOD1 or FUS mutations. All non-SOD1/FUS ALS samples were grouped as “ALS-TDP” in this work for simplicity, although reporting of postmortem TDP-43 inclusions was not systematic and therefore not integrated into the metadata. Confirmed TDP-43 pathology postmortem was reported for all FTLD-TDP samples.

Sample processing, library preparation, and RNA-seq quality control have been extensively described in previous papers ( 10, 49 ). In brief, RNA was extracted from flash-frozen postmortem tissue using TRIzol (Thermo Fisher Scientific) chloroform, and RNA-Seq libraries were prepared from 500 ng total RNA using the KAPA Stranded RNA-Seq Kit with RiboErase (KAPA Biosystems) for rRNA depletion. Pooled libraries (average insert size: 375 bp) passing the quality criteria were sequenced either on an Illumina HiSeq 2500 (125 bp paired end) or an Illumina NovaSeq (100 bp paired end). The samples had a median sequencing depth of 42 million read pairs, with a range between 16 and 167 million read pairs.

Samples were uniformly processed, including adapter trimming with Trimmomatic and alignment to the hg38 genome build using STAR (2.7.2a) ( 32 ) with indexes from GENCODE v30. Extensive quality control was performed using SAMtools ( 50 ) and Picard Tools ( 51 ) to confirm sex and tissue of origin.

Uniquely mapped reads within the UNC13A locus were extracted from each sample using SAMtools. Any read marked as a PCR duplicate by Picard Tools was discarded. Splice junction reads were then extracted with RegTools ( 52 ) using a minimum of 8 bp as an anchor on each side of the junction and a maximum intron size of 500 kb. Junctions from each sample were then clustered together using LeafCutter ( 53 ) with relaxed junction filtering (minimum total reads per junction = 30, minimum fraction of total cluster reads = 0.0001). This produced a matrix of junction counts across all samples.

As the long CE acceptor was detected consistently in control cerebellum samples, as part of an unannotated cerebellum-enriched 35 bp exon containing a stop codon between exons 20 and 21 (sup fig 3C,D), we excluded the long CE acceptor for quantification of UNC13A CE PSI in patient tissue. Only samples with at least 30 spliced reads at the exon locus were included for correlations.

 BaseScope assay

Frozen tissue from the frontal cortex of FTLD-TDP (n = 5), FTLD-Tau (n = 3) and control (n = 3) cases were sectioned at 10 µm thickness onto Plus+Frost microslides (Solmedia). Immediately prior to use, sections were 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 dried at RT and fixed for 15 minutes in pre-chilled 4 % paraformaldehyde. Sections were then dehydrated in increasing grades of ethanol and pre-treated with RNAscope® hydrogen peroxide (10 mins, RT) and protease IV (30 mins, RT). The BaseScope™ v2-RED assay was performed using our UNC13A CE target probe (BA-Hs-UNC13AO1-1zz-st) according to manufacturer guidelines with no modifications (Advanced Cell Diagnostics, Newark, CA). Sections were nuclei counterstained in Mayer’s haematoxylin (BDH) and mounted (VectaMount). Slides were also incubated with a positive control probe (Hs-PPIB-1 ZZ) targeting a common housekeeping gene and a negative control probe (DapB-1 ZZ) which targets a bacterial gene to assess background signal (< 1-2 foci per ~ 100 nuclei). Representative images were taken at x60 magnification.

Hybridised sections were graded, blinded to disease status, according to the relative frequency of red foci which should identify single transcripts with the UNC13A CE event. Grades were prescribed by relative comparison with the negative control slide. - = Less signal than negative control probe; + = similar signal strength to negative control; ++ = visibly greater signal than negative control, +++ = considerably greater signal than negative control.We identified a signal level above background (++ or +++) in 4 of 5 FTLD-TDP cases and a signal considerably above background (+++) level in 2 cases. All FTLD-Tau and control cases were graded as exhibiting either reduced (-) or comparable (+) signal relative to background.

 UNC13A genotypes in the NYGC ALS Consortium

Whole Genome Sequencing (WGS) was carried out for all donors, from DNA extracted from blood or brain tissue. Full details of sample preparation and quality control will be published in a future manuscript. Briefly, paired-end 150bp reads were aligned to the GRCh38 human reference using the Burrows-Wheeler Aligner (BWAMEM v0.7.15) ( 54 ) and processed using the GATK best-practices workflow. This includes marking of duplicate reads by the use of Picard tools( 51 ) (v2.4.1), followed by local realignment around indels, and base quality score recalibration using the Genome Analysis Toolkit ( 55, 56 ) (v3.5). Genotypes for rs12608932 and rs12973192 were then extracted for the samples.

Targeted RNA-seq

RNA was isolated from temporal cortex tissue of 10 FTLD-TDP and four control brains (6M, 4F, average age at death 70.6±5.8y, average disease duration 10.98±5.9y). 50 mg of flash-frozen tissue was homogenised in 700 µl of Qiazol (Qiagen) using a TissueRuptor II (Qiagen). Chloroform was added and RNA subsequently extracted following the spin-column protocol from the miRNeasy kit with DNase digestion (Qiagen). RNA was eluted off the column in 50 µl of RNAse-free water. RNA quantity and quality were evaluated using a spectrophotometer.

Purified RNA was reverse transcribed with Superscript IV (Thermo Fisher Scientific) using either sequence-specific primers containing sample-specific barcodes or random hexamers, following the manufacturer recommendations. Unique molecular identifiers (UMIs) and part of the P5 Illumina sequence were added either during first- or second-strand-synthesis (with Phusion HF 2x Master Mix) respectively. Barcoded primers were removed with exonuclease I treatment (NEB; 30 min) and subsequently bead/size selection of RT/PCR products (TotalPure NGS, Omega Biotek). Three rounds of nested PCR using Phusion HF 2x Master Mix (New England Biolabs) were used to obtain highly specific amplicons for the UNC13A cryptic, followed by gel extraction and a final round of PCR in which the full length P3/P5 Illumina sequences were added. Samples were sequenced with an Illumina HiSeq 4000 machine (SR100).

Raw reads were demultiplexed, adaptor/quality trimmed and UMIs were extracted with Ultraplex (https://github.com/ulelab/ultraplex), then aligned to the hg38 genome with STAR ( 32 ); for the hexamer data, a subsample of reads was used to reduce the number of PCR duplicates during analysis. Reads were deduplicated via analysis of UMIs with a custom R script; to avoid erroneous detection of UMIs due to sequencing errors, UMI sequences with significant similarity to greatly more abundant UMIs were discarded - this methodology was tested using simulated data, and final results were manually verified. Raw reads for targeted RNA-seq are available at EMTAB-10237.

Primers used: Name Specific_RT_1 Specific_RT_2 Specific_RT_3

Sequence ATCACGACGCTCTTCCGATCT NNNN TCATC ACC NNNN CATTGTTCTGCACGTCGGTC ATCACGACGCTCTTCCGATCT NNNN TCATC GGA NNNN CATTGTTCTGCACGTCGGTC ATCACGACGCTCTTCCGATCT NNNN TCATC ATA NNNN CATTGTTCTGCACGTCGGTC

Purpose

Sample P45/15 P28/07 P56/13

Specific_RT_4 ATCACGACGCTCTTCCGATCT NNNN TCATC

TGG NNNN CATTGTTCTGCACGTCGGTC Specific_RT_5 ATCACGACGCTCTTCCGATCT NNNN TCATC

GCT NNNN CATTGTTCTGCACGTCGGTC Specific_RT_6 ATCACGACGCTCTTCCGATCT NNNN TCATC

GTG NNNN CATTGTTCTGCACGTCGGTC Specific_RT_7 ATCACGACGCTCTTCCGATCT NNNN TCATC

CAA NNNN CATTGTTCTGCACGTCGGTC Specific_RT_8 ATCACGACGCTCTTCCGATCT NNNN TCATC

TCA NNNN CATTGTTCTGCACGTCGGTC Specific_RT_9 ATCACGACGCTCTTCCGATCT NNNN TCATC

GAC NNNN CATTGTTCTGCACGTCGGTC Specific_RT_10 ATCACGACGCTCTTCCGATCT NNNN TCATC

CTT NNNN CATTGTTCTGCACGTCGGTC Specific_RT_11 ATCACGACGCTCTTCCGATCT NNNN TCATC

TAT NNNN CATTGTTCTGCACGTCGGTC Specific_RT_12 ATCACGACGCTCTTCCGATCT NNNN TCATC

AGT NNNN CATTGTTCTGCACGTCGGTC Specific_RT_13 ATCACGACGCTCTTCCGATCT NNNN TCATC

TTC NNNN CATTGTTCTGCACGTCGGTC Specific_RT_14 ATCACGACGCTCTTCCGATCT NNNN TCATC

CCG NNNN CATTGTTCTGCACGTCGGTC

ATCACGACGCTC p5_sol_AT_V_ V_short p5_sol_AT_vsho ATCACGACGCTCTTC rt p5_sol_AT

ATCACGACGCTCTTCCGATCT Fwd1 Fwd2 Fwd3

CAAGCGAACTGACAAATC GGCTCCACATCAGTGTG

GTCCAGTACACCTGTCTGC UNC_TAR_FW TACTGAACCGCTCTTCCGATCT D_V2 GTCCAGTACACCTGTCTGC unc_tg3_SSS_1 ATCACGACGCTCTTCCGATCT NNNN AACTC

ACC NNNN CAGATGAATGAGTGATGAGTAG unc_tg3_SSS_2 ATCACGACGCTCTTCCGATCT NNNN AACTC

GGA NNNN CAGATGAATGAGTGATGAGTAG unc_tg3_SSS_3 ATCACGACGCTCTTCCGATCT NNNN AACTC

ATA NNNN CAGATGAATGAGTGATGAGTAG unc_tg3_SSS_4 ATCACGACGCTCTTCCGATCT NNNN AACTC

TGG NNNN CAGATGAATGAGTGATGAGTAG unc_tg3_SSS_5 ATCACGACGCTCTTCCGATCT NNNN AACTC

GCT NNNN CAGATGAATGAGTGATGAGTAG unc_tg3_SSS_6 ATCACGACGCTCTTCCGATCT NNNN AACTC

GTG NNNN CAGATGAATGAGTGATGAGTAG unc_tg3_SSS_7 ATCACGACGCTCTTCCGATCT NNNN AACTC

CAA NNNN CAGATGAATGAGTGATGAGTAG unc_tg3_SSS_8 ATCACGACGCTCTTCCGATCT NNNN AACTC

TCA NNNN CAGATGAATGAGTGATGAGTAG unc_tg3_SSS_9 ATCACGACGCTCTTCCGATCT NNNN AACTC

GAC NNNN CAGATGAATGAGTGATGAGTAG unc_tg3_SSS_10 ATCACGACGCTCTTCCGATCT NNNN AACTC

CTT NNNN CAGATGAATGAGTGATGAGTAG unc_tg3_SSS_11 ATCACGACGCTCTTCCGATCT NNNN AACTC

TAT NNNN CAGATGAATGAGTGATGAGTAG

Method 1 Reverse Transcription Method 1 Reverse Transcription Method 1 Reverse Transcription Method 1 Reverse Transcription Method 1 Reverse Transcription Method 1 Reverse Transcription Method 1 Reverse Transcription Method 1 Reverse Transcription Method 1 Reverse Transcription Method 1 Reverse Transcription Method 1 Reverse Transcription Method 1&2 Nested PCR 1 Method 1&2 Nested PCR 2 Method 1&2 Nested PCR 3 Method 1 Nested PCR 1 Method 1 Nested PCR 2 Method 1 Nested PCR 3

P40/04 P63/05 P64/11 P86/08 P17/07 P47/11 P35/07 P16/09 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 unc_tg3_SSS_12 unc_tg3_SSS_13 unc_tg3_SSS_14 unc_tg3_nest_1 unc_tg3_nest_2 unc_tg3_nest_3 unc_tg3_add_p3

ATCACGACGCTCTTCCGATCT NNNN AACTC AGT NNNN CAGATGAATGAGTGATGAGTAG ATCACGACGCTCTTCCGATCT NNNN AACTC TTC NNNN CAGATGAATGAGTGATGAGTAG ATCACGACGCTCTTCCGATCT NNNN AACTC CCG NNNN CAGATGAATGAGTGATGAGTAG CTGGGATCTTCACGACC ACGACCCCATTGTTCTGC GTTCTGCACGTCGGTCAC TACTGAACCGCTCTTCCGATCT GGTCACGAAGTGGAACAGG

Method 2 second strand synthesis Method 2 second strand synthesis Method 2 second strand synthesis Method 2 Nested PCR 1 Method 2 Nested PCR 2 Method 2 Nested PCR 3 Method 2 - add P3 solexa sequence

 Splicing reporters

One variant of the UNC13A exon 20, intron 20 and exon 21 sequence was synthesised and cloned into a pIRES-EGFP vector (Clontech) by BioCat. Plasmids with all four possible combinations of SNPs were generated by whole-plasmid PCR using primers with 5’ mismatches, followed by phosphorylation and ligation. Stbl3 bacteria grown at 30°C were used due to the observed instability of the plasmids in DH5alpha cells grown at 37°C. Sequences were verified by Sanger sequencing.

TDP-43 inducible knockdown SH-SY5Y cells were electroporated with 2 μg of DNA with the Ingenio electroporation kit (Mirus) using the A-023 setting on an Amaxa II nucleofector (Lonza). The cells were then left untreated or treated for 6 days with 1 μg/mL doxycycline before RNA extraction. Reverse transcription was performed with RervertAid (Thermo Scientific) and cDNA was amplified by nested PCR with miniGene specific primers 5’-TCCTCACTCTCTGACGAGG-3’ and 5’-CATGGCGGTCGACCTAG-3’ followed by UNC13A specific primers 5’-CAAGCGAACTGACAAATCTGCCGTGTCG-3’ and 5’CGACACGGCAGATTTGTCAGTTCGCTTG-3’. PCR products were resolved on a TapeStation 4200 (Agilent) and bands were quantified with TapeStation Systems Software v3.2 (Agilent).

 TDP-43 protein purification

His-tagged TDP-43 was expressed in BL21-DE3 Gold E. coli (Agilent) as previously described ( 57 ). Bacteria were lysed by two hours of gentle shaking in lysis buffer (50 mM sodium phosphate pH 8, 300 mM NaCl, 30 mM imidazole, 1 M urea, 1% v/v Triton X-100, 5 mM beta-mercaptoethanol, with Roche EDTA-free cOmplete protease inhibitor) at room temperature. Samples were centrifuged at 16,000 rpm in a Beckman 25.50 rotor at 4°C for 10 minutes, and the supernatant was clarified by vacuum filtration (0.22 µm).

The clarified lysate was loaded onto a 5 ml His-Trap HP column (Cytiva) equilibrated with Buffer A (50 mM sodium phosphate pH 8, 300 mM NaCl, 20 mM imidazole) using an AKTA Pure system, and eluted with a linear gradient of 0-100% Buffer B (50 mM sodium phosphate pH 8, 300 mM NaCl, 500 mM imidazole) over 90 column volumes. The relevant fractions were then analysed by SDS-PAGE and then extensively dialysed (3.5 kDa cutoff) against ITC buffer (50 mM sodium phosphate pH 7.4, 100 mM NaCl, 1 mM TCEP) at 4°C.

 Isothermal titration calorimetry

RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water, then dialysed against the same stock of ITC buffer overnight at 4°C using 1 kDa Pur-a-lyzer tubes (Merck). Protein and RNA concentrations after dialysis were calculated by A280 and A260 absorbance respectively. ITC measurements were performed on a MicroCal PEAQITC calorimeter (Malvern Panalytical). Titrations were performed at 25°C with TDP-43 (9.6-12 µM) in the cell and RNA (96-120 µM) in the syringe. Data were analysed using the MicroCal PEAQ-ITC analysis software using nonlinear regression with the One set of sites model. For each experiment, the heat associated with ligand dilution was measured and subtracted from the raw data. iCLIP of minigene-transfected cells

HEK293T cells were transfected with either the 2x Healthy or 2x Risk minigenes using Lipofectamine 3000 (Thermofisher Scientific). Each replicate consisted of 2x 3.5 cm dishes, with two replicates per sample, for eight dishes total. 48 h after transfection, cells were crosslinked with 150 mJ/cm2 at 254 nm on ice, pelleted and flash frozen. Immunoprecipitations were performed with 4ug of TDP-43 antibody (proteintech 10782-2-AP) with 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 100ul of protein G dynabeads per sample, and iCLIP sequencing libraries were prepared as described in ( 43 ). Libraries were sequenced on an Illumina HiSeq4000 machine (SR100).

After demultiplexing the reads with Ultraplex, we initially aligned to the human genome using STAR ( 32 ), which showed that >5% of uniquely aligned reads mapped solely to the genomic region that is contained in the minigene. Given the high prior probability of reads mapping to the minigene, we therefore instead used Bowtie2 to align to the respective minigene sequences alone, thus minimising mis-mapping biases that could be caused by the SNPs( 44 ) with settings “--norc --no-unal --rdg 50,50 --rfg 50,50 --score-min L,-2,-0.2 --end-to-end -N 1”, then filtered for reads with no alignment gaps, and length >25 nt. Due to the exceptional read depth and high library complexity, we did not perform PCR deduplication to avoid UMI saturation at signal peaks. All downstream analysis was performed using custom R scripts. Raw data is available at E-MTAB-10297. 1093 1094 1095 1096 1097 1098 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141

Expression of splice junction reads supporting the UNC13A CE across tissues and disease subtypes. Junction counts are normalised by library size in millions (junctions per million). The long novel acceptor junction is expressed across all disease subtypes in the cerebellum. (D) Example RNA-seq traces from IGV showing UNC13A cerebellar exon which shares the long novel acceptor junction as the UNC13A CE (E) Percentage disease relevant tissue samples with detectable UNC13A CE (1 supporting spliced read), split by disease and tissue. 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 name UNC13B_annotated STMN2_annotated STMN2_cryptic UNC13A_NovelDonor UNC13A_annotated UNC13A_ShortNovelAccep UNC13A_LongNovelAccep chromosome

start chr9 chr9 chr9 chr8 chr8 35313989 35313989 35364567 79611214 79611214 17641556 17641556 17642541 17642591 end 35366947 35364545 35366947 79636802 79616822 17642414 17642845 17642845 17642845 ime ime tor tor

strand r_bed_format 0 1162 1163 1164 1165 1166 1167 1169 1170 List of differentially spliced junctions between control and TDP-43 KD i3Neurons (Fig. 1A).

 Data S2. (separate file)

List of differentially expressed genes between control and TDP-43 KD i3Neurons (Fig. 1B).

 Data S3. (separate file) Data S4. (separate file)

List of differentially ribosomal profiling genes between control and TDP-43 KD i3Neurons (Fig

 1. R. Ferrari , D. Kapogiannis , E. D. Huey , P. Momeni, FTD and ALS: a tale of two diseases . Curr. Alzheimer Res . 8 , 273 – 294 ( 2011 ). 2. P. Couratier , P. Corcia , G. Lautrette, M. Nicol , B. Marin , ALS and frontotemporal dementia belong to a common disease spectrum . Rev. Neurol . (Paris). 173 , 273 – 279 ( 2017 ). 3. A.-L. Ji , X. Zhang , W.-W. Chen, W.-J. Huang, Genetics insight into the amyotrophic lateral sclerosis/frontotemporal dementia spectrum . J. Med. Genet . 54 , 145 – 154 ( 2017 ). 4. M. A. van Es , J. H. Veldink , C. G. J. Saris , H. M. Blauw , P. W. J. van Vught , A. Birve , R. Lemmens , H. J. Schelhaas , E. J. N. Groen , M. H. B. Huisman , A. J. van der Kooi , M. de Visser, C. Dahlberg , K. Estrada , F. Rivadeneira , A. Hofman , M. J. Zwarts , P. T. C. van Doormaal , D. Rujescu , E. Strengman , I. Giegling , P. Muglia , B. Tomik , A. Slowik , A. G. Uitterlinden , C. Hendrich , S. Waibel , T. Meyer, A. C. Ludolph , J. D. Glass , S. Purcell , S. Cichon , M. M. Nöthen , H.-E. Wichmann, S. Schreiber , S. H. H. M. Vermeulen , L. A. Kiemeney , J. H. J. Wokke , S. Cronin , R. L. McLaughlin , O. Hardiman , K. Fumoto , R. J. Pasterkamp , V. Meininger , J. Melki , P. N. Leigh , C. E. Shaw , J. E. Landers , A. Al-Chalabi , R. H. Brown , W. Robberecht, P. M. Andersen , R. A. Ophoff , L. H. van den Berg , Genomewide association study identifies 19p13.3 ( UNC13A ) and 9p21.2 as susceptibility loci for sporadic amyotrophic lateral sclerosis . Nat. Genet . 41 , 1083 – 1087 ( 2009 ). 5. M. Neumann , D. M. Sampathu , L. K. Kwong , A. C. Truax , M. C. Micsenyi , T. T. Chou, J. Bruce , T. Schuck , M. Grossman , C. M. Clark , L. F. McCluskey , B. L. Miller , E. Masliah , I. R. Mackenzie , H. Feldman , W. Feiden , H. A. Kretzschmar , J. Q. Trojanowski , V. M.- Y. Lee , Ubiquitinated TDP -43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis . Science . 314 , 130 – 133 ( 2006 ). 6. J. Humphrey , W. Emmett , P. Fratta , A. M. Isaacs , V. Plagnol , Quantitative analysis of cryptic splicing associated with TDP-43 depletion . BMC Med . Genomics. 10 , 38 ( 2017 ). 7. J. P. Ling , O. Pletnikova , J. C. Troncoso , P. C. Wong, TDP-43 repression of nonconserved cryptic exons is compromised in ALS-FTD . Science . 349 , 650 – 655 ( 2015 ). 8. J. R. Klim , L. A. Williams , F. Limone , I. Guerra San Juan, B. N. Davis-Dusenbery , D. A. Mordes , A. Burberry , M. J. Steinbaugh , K. K. Gamage , R. Kirchner , R. Moccia , S. H. Cassel , K. Chen , B. J. Wainger , C. J. Woolf , K. Eggan , ALS-implicated protein TDP-43 sustains levels of STMN2, a mediator of motor neuron growth and repair . Nat. Neurosci . 22 , 167 – 179 ( 2019 ). 9. Z. Melamed , J. Lopez-Erauskin , M. W. Baughn , O. Zhang , K. Drenner , Y. Sun , F. Freyermuth , M. A. McMahon , M. S. Beccari , J. Artates , T. Ohkubo , M. Rodriguez , N. Lin , D. Wu , C. F. Bennett , F. Rigo , S. Da Cruz , J. Ravits , C. Lagier-Tourenne , D. W. Cleveland , Premature polyadenylation-mediated loss of stathmin-2 is a hallmark of TDP-43-dependent neurodegeneration . Nat. Neurosci . 22 , 180 – 190 ( 2019 ). 10. M. Prudencio , J. Humphrey , S. Pickles , A.-L. Brown , S. E. Hill , J. Kachergus , J. Shi , M. Heckman , M. Spiegel , C. Cook , Truncated stathmin-2 is a marker of TDP-43 pathology in frontotemporal dementia . J. Clin. Invest . ( 2020 ). 11. M. S. Fernandopulle , R. Prestil , C. Grunseich , C. Wang , L. Gan , M. E. Ward , Transcription Factor– Mediated Differentiation of Human iPSCs into Neurons . Curr. Protoc. Cell Biol . 79 , e51 ( 2018 ). 12. R. Tian , M. A. Gachechiladze , C. H. Ludwig , M. T. Laurie , J. Y. Hong , D. Nathaniel , A. V. Prabhu , M. S. Fernandopulle , R. Patel , M. Abshari , M. E. Ward , M. Kampmann, CRISPR Interference-Based Platform for Multimodal Genetic Screens in Human iPSC-Derived Neurons . Neuron. 104 , 239 - 255 . e12 ( 2019 ). 13. C. Wang , M. E. Ward , R. Chen , K. Liu, T. E. Tracy , X. Chen , M. Xie , P. D. Sohn , C. Ludwig , A. Meyer-Franke, C. M. Karch , S. Ding , L. Gan, Scalable Production of iPSCDerived Human Neurons to Identify Tau-Lowering Compounds by High-Content Screening . Stem Cell Rep . 9 , 1221 – 1233 ( 2017 ). 14. F. P. Diekstra , P. W. J. van Vught , W. van Rheenen, M. Koppers , R. J. Pasterkamp , M. A. van Es , H. J. Schelhaas , M. de Visser, W. Robberecht, P. Van Damme , P. M. Andersen , L. H. van den Berg , J. H. Veldink , Neurobiol. Aging, in press, doi:10.1016/j.neurobiolaging. 2011 . 10 .029. 15. F. P. Diekstra , V. M. Van Deerlin , J. C. van Swieten , A. Al-Chalabi , A. C. Ludolph , J. H. Weishaupt , O. Hardiman , J. E. Landers , R. H. Brown , M. A. van Es , R. J. Pasterkamp , M. Koppers , P. M. Andersen , K. Estrada , F. Rivadeneira , A. Hofman , A. G. Uitterlinden , P. van Damme , J. Melki , V. Meininger , A. Shatunov , C. E. Shaw , P. N. Leigh , P. J. Shaw , K. E. Morrison , I. Fogh , A. Chiò , B. J. Traynor , D. Czell , M. Weber , P. Heutink , P. I. W. de Bakker, V. Silani , W. Robberecht , L. H. van den Berg , J. H. Veldink , C9orf72 and UNC13A are shared risk loci for ALS and FTD: a genome-wide meta-analysis . Ann. Neurol . 76 , 120 – 133 ( 2014 ). 16. B. Gaastra , A. Shatunov , S. Pulit , A. R. Jones , W. Sproviero , A. Gillett , Z. Chen , J. Kirby , I. Fogh , J. F. Powell , P. N. Leigh , K. E. Morrison , P. J. Shaw , C. E. Shaw , L. H. van den Berg , J. H. Veldink , C. M. Lewis , A . Al-Chalabi , Rare genetic variation in UNC13A may modify survival in amyotrophic lateral sclerosis . Amyotroph. Lateral Scler. Front. Degener . 17 , 593 – 599 ( 2016 ). 18. K. Placek , G. M. Baer , L. Elman , L. McCluskey , L. Hennessy , P. M. Ferraro , E. B. Lee , V. M.- Y. Lee , J. Q. Trojanowski , V. M. Van Deerlin , M. Grossman , D. J. Irwin , C. T. McMillan , UNC13A polymorphism contributes to frontotemporal disease in sporadic amyotrophic lateral sclerosis . Neurobiol. Aging . 73 , 190 – 199 ( 2019 ). 20. B. Yang , H. Jiang , F. Wang , S. Li , C. Wu , J. Bao , Y. Zhu , Z. Xu , B. Liu , H. Ren , X. Yang, UNC13A variant rs12608932 is associated with increased risk of amyotrophic lateral sclerosis and reduced patient survival: a meta-analysis . Neurol. Sci . 40 , 2293 – 2302 ( 2019 ). 21. R. P. A. van Eijk , M. J. C. Eijkemans , S. Nikolakopoulos , M. D. Jansen , H. - J. Westeneng , K. R. van Eijk , R. A. A. van der Spek , J. J. F. A. van Vugt , S. Piepers , G.-J. Groeneveld , J. H. Veldink , L. H. van den Berg, M. A. van Es , Pharmacogenetic interactions in amyotrophic lateral sclerosis: a step closer to a cure? Pharmacogenomics J . 20 , 220 – 226 ( 2020 ). 22. J. R. Tollervey , T. Curk , B. Rogelj , M. Briese , M. Cereda , M. Kayikci , T. Hortobágyi , A. L. Nishimura , V. Župunski, R. Patani , S. Chandran , G. Rot , B. Zupan , C. E. Shaw , J. Ule , Characterising the RNA targets and position-dependent splicing regulation by TDP-43; implications for neurodegenerative diseases . Nat. Neurosci . 14 , 452 – 458 ( 2011 ). 23. C. Appocher , F. Mohagheghi , S. Cappelli , C. Stuani , M. Romano , F. Feiguin , E. Buratti, Major hnRNP proteins act as general TDP-43 functional modifiers both in Drosophila and human neuronal cells . Nucleic Acids Res . 45 , 8026 – 8045 ( 2017 ). 24. E. Y. Liu, J. Russ , C. P. Cali , J. M. Phan , A. Amlie-Wolf , E. B. Lee Correspondence , Loss of Nuclear TDP-43 Is Associated with Decondensation of LINE Retrotransposons . CellReports . 27 , 1409 - 1421 . e6 ( 2019 ). 25. J. R. Burrell , G. M. Halliday , J. J. Kril , L. M. Ittner , J. Götz , M. C. Kiernan , J. R. Hodges , The frontotemporal dementia-motor neuron disease continuum . The Lancet . 388 , 919 – 931 ( 2016 ). 26. D. Ray , H. Kazan , K. B. Cook , M. T. Weirauch , H. S. Najafabadi , X. Li , S. Gueroussov , M. Albu , H. Zheng , A. Yang , H. Na , M. Irimia , L. H. Matzat , R. K. Dale , S. A. Smith , C. A. Yarosh , S. M. Kelly , B. Nabet , D. Mecenas , W. Li , R. S. Laishram , M. Qiao , H. D. Lipshitz , F. Piano , A. H. Corbett , R. P. Carstens , B. J. Frey , R. A. Anderson , K. W. Lynch , L. O. F. Penalva , E. P. Lei , A. G. Fraser , B. J. Blencowe , Q. D. Morris , T. R. Hughes , A compendium of RNA-binding motifs for decoding gene regulation . Nature . 499 , 172 – 177 ( 2013 ). 27. E. H. Corder , A. M. Saunders , W. J. Strittmatter , D. E. Schmechel , P. C. Gaskell , G. W. Small , A. D. Roses , J. L. Haines , M. A. Pericak-Vance , Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer’s disease in late onset families . Science . 261 , 921 – 923 ( 1993 ). 28. J. S. Dittman , Unc13: a multifunctional synaptic marvel . Curr. Opin. Neurobiol . 57 , 17 – 25 ( 2019 ). 29. F. Varoqueaux , A. Sigler , J.-S. Rhee , N. Brose , C. Enk , K. Reim , C. Rosenmund , Total arrest of spontaneous and evoked synaptic transmission but normal synaptogenesis in the absence of Munc13-mediated vesicle priming . Proc. Natl. Acad. Sci . U. S. A. 99 , 9037 – 9042 ( 2002 ). 30. F. Varoqueaux , M. S. Sons, J. J. Plomp , N. Brose , Aberrant Morphology and Residual Transmitter Release at the Munc13-Deficient Mouse Neuromuscular Synapse . Mol. Cell. Biol . 25 , 5973 – 5984 ( 2005 ). 31. L. A. Gilbert , M. A. Horlbeck , B. Adamson , J. E. Villalta , Y. Chen , E. H. Whitehead , C. Guimaraes , B. Panning , H. L. Ploegh , M. C. Bassik , L. S. Qi , M. Kampmann , J. S. Weissman , Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation . Cell . 159 , 647 – 661 ( 2014 ). 32. A. Dobin , C. A. Davis , F. Schlesinger , J. Drenkow , C. Zaleski , S. Jha , P. Batut , M. Chaisson , T. R. Gingeras , Sequence analysis STAR: ultrafast universal RNA-seq aligner . 29 , 15 – 21 ( 2013 ). 33. A. Frankish , M. Diekhans , A.-M. Ferreira , R. Johnson , I. Jungreis, J. Loveland , J. M. Mudge , C. Sisu , J. Wright , J. Armstrong , I. Barnes , A. Berry , A. Bignell , S. Carbonell Sala, J. Chrast , F. Cunningham , T. Di Domenico , S. Donaldson , I. T. Fiddes , C. García Girón , J. M. Gonzalez , T. Grego , M. Hardy , T. Hourlier , T. Hunt , O. G. Izuogu , J. Lagarde , F. J. Martin , L. Martínez , S. Mohanan , P. Muir , F. C. P. Navarro , A. Parker , B. Pei , F. Pozo , M. Ruffier , B. M. Schmitt , E. Stapleton, M.-M. Suner , I. Sycheva , B. Uszczynska-Ratajczak , J. Xu , A. Yates , D. Zerbino , Y. Zhang , B. Aken , J. S. Choudhary , M. Gerstein , R. Guigó , T. J. P. Hubbard , M. Kellis , B. Paten , A. Reymond , M. L. Tress , P. Flicek, GENCODE reference annotation for the human and mouse genomes . Nucleic Acids Res . 47 , D766 – D773 ( 2019 ). 34. Y. Liao , G. K. Smyth , W. Shi, featureCounts: an efficient general purpose program for assigning sequence reads to genomic features . Bioinformatics . 30 , 923 – 930 ( 2014 ). 35. M. I. Love , W. Huber , S. Anders , Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 . Genome Biol . 15 , 550 ( 2014 ). 36. F. Mölder , K. P. Jablonski , B. Letcher , M. B. Hall , C. H. Tomkins-Tinch , V. Sochat , J. Forster , S. Lee , S. O. Twardziok , A. Kanitz , A. Wilm , M. Holtgrewe , S. Rahmann , S. Nahnsen , J. Köster , Sustainable data analysis with Snakemake . F1000Research . 10 , 33 ( 2021 ). 37. J. Vaquero-Garcia , A. Barrera , M. R. Gazzara , J. González-Vallinas , N. F. Lahens , J. B. Hogenesch , K. W. Lynch , Y. Barash , A new view of transcriptome complexity and regulation through the lens of local splicing variations . eLife. 5 , e11752 ( 2016 ). 38. A. R. Quinlan , I. M. Hall , BEDTools: a flexible suite of utilities for comparing genomic features . Bioinformatics . 26 , 841 – 842 ( 2010 ). 39. R. Middleton , D. Gao , A. Thomas , B. Singh , A. Au , J. J.-L. Wong , A. Bomane , B. Cosson , E. Eyras , J. E. J. Rasko , W. Ritchie, IRFinder: assessing the impact of intron retention on mammalian gene expression . Genome Biol . 18 , 51 ( 2017 ). 40. K. J. Livak , T. D. Schmittgen , Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method . Methods . 25 , 402 – 408 ( 2001 ). 41. A. P. Pereverzev , N. G. Gurskaya , G. V. Ermakova , E. I. Kudryavtseva , N. M. Markina , A. A. Kotlobay , S. A. Lukyanov , A. G. Zaraisky , K. A. Lukyanov , Method for quantitative analysis of nonsense-mediated mRNA decay at the single cell level . Sci. Rep . 5 , 7729 ( 2015 ). 42. J. Humphrey , N. Birsa , C. Milioto , M. McLaughlin , A. M. Ule , D. Robaldo , A. B. Eberle , R. Kräuchi , M. Bentham , A.-L. Brown , S. Jarvis, C. Bodo , M. G. Garone , A. Devoy , G. Soraru , A. Rosa , I. Bozzoni , E. M. C. Fisher , O. Mühlemann , G. Schiavo, M.-D. Ruepp , A. M. Isaacs , V. Plagnol , P. Fratta, FUS ALS-causative mutations impair FUS autoregulation and splicing factor networks through intron retention . Nucleic Acids Res . 48 , 6889 – 6905 ( 2020 ). 43. L. Blazquez , W. Emmett , R. Faraway , J. M. B. Pineda , S. Bajew , A. Gohr , N. Haberman , C. R. Sibley , R. K. Bradley , M. Irimia , J. Ule , Exon Junction Complex Shapes the Transcriptome by Repressing Recursive Splicing . Mol. Cell . 72 , 496 - 509 . e9 ( 2018 ). 44. B. Langmead , S. L. Salzberg , Fast gapped-read alignment with Bowtie 2 . Nat . Methods . 9 , 357 – 359 ( 2012 ). 45. T. Smith , A. Heger , I. Sudbery , UMI-tools: modeling sequencing errors in Unique Molecular Identifiers to improve quantification accuracy . Genome Res . 27 , 491 – 499 ( 2017 ). 46. A. Buniello , J. A. L. MacArthur , M. Cerezo , L. W. Harris , J. Hayhurst , C. Malangone , A. McMahon , J. Morales , E. Mountjoy , E. Sollis , D. Suveges , O. Vrousgou , P. L. Whetzel , R. Amode , J. A. Guillen , H. S. Riat , S. J. Trevanion , P. Hall, H. Junkins , P. Flicek , T. Burdett , L. A. Hindorff , F. Cunningham , H. Parkinson , The NHGRI-EBI GWAS Catalog of published genome-wide association studies, targeted arrays and summary statistics 2019. Nucleic Acids Res . 47 , D1005 – D1012 ( 2019 ). 47. R. J. Pruim , R. P. Welch , S. Sanna , T. M. Teslovich , P. S. Chines , T. P. Gliedt , M. Boehnke , G. R. Abecasis , C. J. Willer , LocusZoom: regional visualization of genome-wide association scan results . Bioinforma. Oxf. Engl . 26 , 2336 – 2337 ( 2010 ). 48. 1000 Genomes Project Consortium , A. Auton , L. D. Brooks , R. M. Durbin , E. P. Garrison , H. M. Kang , J. O. Korbel , J. L. Marchini , S. McCarthy , G. A. McVean , G. R. Abecasis , A global reference for human genetic variation . Nature . 526 , 68 – 74 ( 2015 ). 49. O. H. Tam , N. V. Rozhkov , R. Shaw , J. Ravits , J. Dubnau , M. Gale , H. Correspondence , Postmortem Cortex Samples Identify Distinct Molecular Subtypes of ALS: Retrotransposon Activation, Oxidative Stress, and Activated Glia . Cell Rep . 29 ( 2019 ), doi:10.1016/j.celrep. 2019 . 09 .066. 50. H. Li , B. Handsaker , A. Wysoker , T. Fennell , J. Ruan , N. Homer , G. Marth, G. Abecasis, R. Durbin , 1000 Genome Project Data Processing Subgroup, The Sequence Alignment/Map format and SAMtools. Bioinforma. Oxf. Engl. 25 , 2078 – 2079 ( 2009 ). 51. Picard toolkit. Broad Inst. GitHub Repos . ( 2019 ) (available at http://broadinstitute.github.io/picard/). 52. K. C. Cotto , Y.-Y. Feng , A. Ramu , Z. L. Skidmore , J. Kunisaki , M. Richters , S. Freshour , Y. Lin , W. C. Chapman , R. Uppaluri , R. Govindan , O. L. Griffith , M. Griffith, RegTools: Integrated analysis of genomic and transcriptomic data for the discovery of splicing variants in cancer . bioRxiv, 436634 ( 2021 ). 53. Y. I. Li , D. A. Knowles , J. Humphrey , A. N. Barbeira , S. P. Dickinson , H. K. Im , J. K. Pritchard , Annotation-free quantification of RNA splicing using LeafCutter . Nat. Genet . 50 , 151 – 158 ( 2018 ). 54. H. Li , Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. ArXiv13033997 Q-Bio ( 2013 ) (available at http://arxiv.org/abs/1303.3997). 55. M. A. DePristo , E. Banks, R. Poplin , K. V. Garimella , J. R. Maguire , C. Hartl , A. A. Philippakis , G. del Angel , M. A. Rivas , M. Hanna , A. McKenna , T. J. Fennell , A. M. Kernytsky , A. Y. Sivachenko , K. Cibulskis , S. B. Gabriel , D. Altshuler , M. J. Daly , A framework for variation discovery and genotyping using next-generation DNA sequencing data . Nat. Genet . 43 , 491 – 498 ( 2011 ). 56. A. McKenna , M. Hanna , E. Banks , A. Sivachenko , K. Cibulskis , A. Kernytsky , K. Garimella , D. Altshuler , S. Gabriel, M. Daly, M. A. DePristo, The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data . Genome Res . 20 , 1297 – 1303 ( 2010 ). 57. P. J. Lukavsky , D. Daujotyte , J. R. Tollervey , J. Ule , C. Stuani , E. Buratti , F. E. Baralle , F. F. Damberger , F. H.-T. Allain , Molecular basis of UG-rich RNA recognition by the human splicing factor TDP-43 . Nat. Struct. Mol. Biol . 20 , 1443 – 1449 ( 2013 ).